Regulon of AmtR in Rhodococcus erythropolis PR4

Properties
Regulator type:	Transcription factor
TF locus tag:	RER_29510
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Nitrogen metabolism
Effector:	GlnK-AMP, signal transduction protein
Regulog:	AmtR - Nocardiaceae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Nocardiaceae
By trascription factor - AmtR
By TF family - TetR
By effector - GlnK-AMP, signal transduction protein
By pathway - Nitrogen metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -58 Score: 6.9 Sequence: GAAAACTATCAATCGACAGTTATT Locus tag: RER_29520 Name: uctT Funciton: Urea carboxylase-related transporter, Amino acid permease family Locus tag: RER_29530 Name: amt1 Funciton: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) Locus tag: RER_29540 Name: amt2 Funciton: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) Locus tag: RER_29550 Name: ucaA Funciton: Urea carboxylase (EC 6.3.4.6)
	RER_29520	uctT	Urea carboxylase-related transporter, Amino acid permease family
	RER_29530	amt1	Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
	RER_29540	amt2	Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
	RER_29550	ucaA	Urea carboxylase (EC 6.3.4.6)
Position: -172 Score: 7.1 Sequence: AATAACTGTCGATTGATAGTTTTC Locus tag: RER_29510 Name: amtR Funciton: Transcriptional regulator of urea utilization, TetR family
	RER_29510	amtR	Transcriptional regulator of urea utilization, TetR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD