Regulon of AmtR in Rhodococcus opacus B4

Properties
Regulator type:	Transcription factor
TF locus tag:	ROP_68870
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Nitrogen metabolism
Effector:	GlnK-AMP, signal transduction protein
Regulog:	AmtR - Nocardiaceae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Nocardiaceae
By trascription factor - AmtR
By TF family - TetR
By effector - GlnK-AMP, signal transduction protein
By pathway - Nitrogen metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -171 Score: 7.2 Sequence: AATATCTGTCGATCGATAGTTTTC Locus tag: ROP_68870 Name: amtR Funciton: Transcriptional regulator of urea utilization, TetR family
	ROP_68870	amtR	Transcriptional regulator of urea utilization, TetR family
Position: -47 Score: 6.9 Sequence: GAAAACTATCGATCGACAGATATT Locus tag: ROP_68880 Name: uctT Funciton: Urea carboxylase-related transporter, Amino acid permease family Locus tag: ROP_68890 Name: amt1 Funciton: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) Locus tag: ROP_68900 Name: amt2 Funciton: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) Locus tag: ROP_68910 Name: ucaA Funciton: Urea carboxylase (EC 6.3.4.6)
	ROP_68880	uctT	Urea carboxylase-related transporter, Amino acid permease family
	ROP_68890	amt1	Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
	ROP_68900	amt2	Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
	ROP_68910	ucaA	Urea carboxylase (EC 6.3.4.6)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD