Regulog SO4468 - Shewanellaceae
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Shewanellaceae
- By TF family - TetR
| Genome | Genes | Operons |
|---|---|---|
| Shewanella oneidensis MR-1 | 2 | 2 |
| Shewanella putrefaciens CN-32 | 5 | 2 |
| Shewanella sp W3-18-1 | 5 | 2 |
| Shewanella sp ANA-3 | 2 | 2 |
| Shewanella sp MR-4 | 2 | 2 |
| Shewanella sp MR-7 | 2 | 2 |
| Shewanella baltica OS155 | 4 | 2 |
| Shewanella denitrificans OS217 | 4 | 2 |
| Shewanella frigidimarina NCIMB 400 | ||
| Shewanella amazonensis SB2B | 2 | 2 |
| Shewanella loihica PV-4 | ||
| Shewanella pealeana ATCC 700345 | ||
| Shewanella halifaxensis HAW-EB4 | ||
| Shewanella piezotolerans WP3 | 4 | 2 |
| Shewanella sediminis HAW-EB3 | 3 | 2 |
| Shewanella woodyi ATCC 51908 |
| Genes | Function | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||||
| SO4469 |
*
Shewanella oneidensis MR-1 Site: position = -52 score = 5.99367 sequence = CTAGACGACTGGTCTACTAA Gene: SO_4469: Alcohol dehydrogenase, iron-containing |
*
Shewanella putrefaciens CN-32 Site: position = -64 score = 5.8785 sequence = TTAGACGACTGGTCTACTAA Gene: Sputcn32_0377: Alcohol dehydrogenase, iron-containing |
*
Shewanella sp W3-18-1 Site: position = -64 score = 5.8785 sequence = TTAGACGACTGGTCTACTAA Gene: Sputw3181_0227: Alcohol dehydrogenase, iron-containing |
*
Shewanella sp ANA-3 Site: position = -52 score = 5.99367 sequence = CTAGACGACTGGTCTACTAA Gene: Shewana3_0261: Alcohol dehydrogenase, iron-containing |
*
Shewanella sp MR-4 Site: position = -51 score = 5.99367 sequence = CTAGACGACTGGTCTACTAA Gene: Shewmr4_0260: Alcohol dehydrogenase, iron-containing |
*
Shewanella sp MR-7 Site: position = -51 score = 5.99367 sequence = CTAGACGACTGGTCTACTAA Gene: Shewmr7_3761: Alcohol dehydrogenase, iron-containing |
*
Shewanella baltica OS155 Site: position = -104 score = 5.8785 sequence = TTAGACGACTGGTCTACTAA Gene: Sbal_0271: Alcohol dehydrogenase, iron-containing |
Gene: Sden_1715: Alcohol dehydrogenase, iron-containing |
2
Shewanella frigidimarina NCIMB 400 Gene: Sfri_2033: Alcohol dehydrogenase, iron-containing Gene: Sfri_0073: Alcohol dehydrogenase, iron-containing |
|
Gene: Shew_0070: Alcohol dehydrogenase, iron-containing |
Gene: Spea_3925: Alcohol dehydrogenase, iron-containing |
Gene: Shal_0346: Alcohol dehydrogenase, iron-containing |
*
Shewanella piezotolerans WP3 Site: position = -62 score = 5.99367 sequence = CTAGACGACTGGTCTACTAA Gene: swp_0256: Alcohol dehydrogenase, iron-containing |
*
Shewanella sediminis HAW-EB3 Site: position = -59 score = 5.99367 sequence = CTAGACGACTGGTCTACTAA Gene: Ssed_0286: Alcohol dehydrogenase, iron-containing |
|
Alcohol dehydrogenase, iron-containing |
| Sbal_0270 |
|
Gene: Sputcn32_0376: ThiJ/PfpI family protein |
Gene: Sputw3181_0226: ThiJ/PfpI family protein |
|
|
|
Gene: Sbal_0270: ThiJ/PfpI family protein |
Gene: Sden_1386: ThiJ/PfpI family protein |
Gene: Sfri_0805: ThiJ/PfpI family protein |
|
|
Gene: Spea_3926: ThiJ/PfpI family protein |
Gene: Shal_0345: ThiJ/PfpI family protein |
Gene: swp_0255: ThiJ/PfpI family protein |
Gene: Ssed_0285: ThiJ/PfpI family protein |
|
ThiJ/PfpI family protein |
| Sbal_0269 |
|
2
Shewanella putrefaciens CN-32 Gene: Sputcn32_0375: Glutathione S-transferase (EC 2.5.1.18) Gene: Sputcn32_0374: Glutathione S-transferase (EC 2.5.1.18) |
2
Shewanella sp W3-18-1 Gene: Sputw3181_0224: Glutathione S-transferase (EC 2.5.1.18) Gene: Sputw3181_0225: Glutathione S-transferase (EC 2.5.1.18) |
|
|
|
Gene: Sbal_0269: Glutathione S-transferase (EC 2.5.1.18) |
Gene: Sden_1385: Glutathione S-transferase (EC 2.5.1.18) |
Gene: Sfri_0806: Glutathione S-transferase (EC 2.5.1.18) |
|
|
|
|
Gene: swp_0254: Glutathione S-transferase (EC 2.5.1.18) |
|
|
Glutathione S-transferase (EC 2.5.1.18) |
| Sden_1387 |
|
|
|
|
|
|
|
*
Shewanella denitrificans OS217 Site: position = -31 score = 5.85637 sequence = CTAGACGACCGGTCTATTAA Gene: Sden_1387: Putative oxidoreductase YncB |
Gene: Sfri_0804: Putative oxidoreductase YncB |
*
Shewanella amazonensis SB2B Site: position = -37 score = 5.61217 sequence = CTAGACGACTGGTCTAATTT Gene: Sama_0475: Putative oxidoreductase YncB |
|
|
|
|
|
|
Putative oxidoreductase YncB |
| CRON 2. | |||||||||||||||||
| SO4468 |
*
Shewanella oneidensis MR-1 Site: position = -38 score = 5.61217 sequence = CTAGACGACTGGTCTAATTT Gene: SO_4468: Transcriptional regulator, TetR family |
*
Shewanella putrefaciens CN-32 Site: position = -25 score = 5.71724 sequence = CTAGACGACCGGTCTAATTT Gene: Sputcn32_0378: Transcriptional regulator, TetR family |
*
Shewanella sp W3-18-1 Site: position = -25 score = 5.71724 sequence = CTAGACGACCGGTCTAATTT Gene: Sputw3181_0228: Transcriptional regulator, TetR family |
*
Shewanella sp ANA-3 Site: position = -38 score = 5.79462 sequence = CTAGACGACTGGTCTAATAT Gene: Shewana3_0262: Transcriptional regulator, TetR family |
*
Shewanella sp MR-4 Site: position = -38 score = 5.61217 sequence = CTAGACGACTGGTCTAATTT Gene: Shewmr4_0261: Transcriptional regulator, TetR family |
*
Shewanella sp MR-7 Site: position = -38 score = 5.61217 sequence = CTAGACGACTGGTCTAATTT Gene: Shewmr7_3760: Transcriptional regulator, TetR family |
*
Shewanella baltica OS155 Site: position = -37 score = 5.64793 sequence = CTAGACGACCGGTCTATTTT Gene: Sbal_0272: Transcriptional regulator, TetR family |
*
Shewanella denitrificans OS217 Site: position = -36 score = 5.85839 sequence = CTAGACGACCGGTCTAATTG Gene: Sden_1388: Transcriptional regulator, TetR family |
|
*
Shewanella amazonensis SB2B Site: position = -37 score = 5.63364 sequence = CTAGACGACTGGTCTAATCG Gene: Sama_0476: Transcriptional regulator, TetR family |
|
|
|
*
Shewanella piezotolerans WP3 Site: position = -37 score = 5.56764 sequence = CTAGACGACCGGTCTAATAC Gene: swp_0257: Transcriptional regulator, TetR family |
*
Shewanella sediminis HAW-EB3 Site: position = -36 score = 5.52826 sequence = CTAGACGACCGGTCTATTCT Gene: Ssed_0287: Transcriptional regulator, TetR family |
|
Transcriptional regulator, TetR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |