Regulog SO4468 - Shewanellaceae

Properties
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:
Effector:
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - TetR

Statistics of regulated genes
Genome	Genes	Operons
Shewanella oneidensis MR-1	2	2
Shewanella putrefaciens CN-32	5	2
Shewanella sp W3-18-1	5	2
Shewanella sp ANA-3	2	2
Shewanella sp MR-4	2	2
Shewanella sp MR-7	2	2
Shewanella baltica OS155	4	2
Shewanella denitrificans OS217	4	2
Shewanella frigidimarina NCIMB 400
Shewanella amazonensis SB2B	2	2
Shewanella loihica PV-4
Shewanella pealeana ATCC 700345
Shewanella halifaxensis HAW-EB4
Shewanella piezotolerans WP3	4	2
Shewanella sediminis HAW-EB3	3	2
Shewanella woodyi ATCC 51908

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																	Function

CRON 1.
SO4469	* Shewanella oneidensis MR-1 Site: position = -52 score = 5.99367 sequence = CTAGACGACTGGTCTACTAA Gene: SO_4469: Alcohol dehydrogenase, iron-containing	* Shewanella putrefaciens CN-32 Site: position = -64 score = 5.8785 sequence = TTAGACGACTGGTCTACTAA Gene: Sputcn32_0377: Alcohol dehydrogenase, iron-containing	* Shewanella sp W3-18-1 Site: position = -64 score = 5.8785 sequence = TTAGACGACTGGTCTACTAA Gene: Sputw3181_0227: Alcohol dehydrogenase, iron-containing	* Shewanella sp ANA-3 Site: position = -52 score = 5.99367 sequence = CTAGACGACTGGTCTACTAA Gene: Shewana3_0261: Alcohol dehydrogenase, iron-containing	* Shewanella sp MR-4 Site: position = -51 score = 5.99367 sequence = CTAGACGACTGGTCTACTAA Gene: Shewmr4_0260: Alcohol dehydrogenase, iron-containing	* Shewanella sp MR-7 Site: position = -51 score = 5.99367 sequence = CTAGACGACTGGTCTACTAA Gene: Shewmr7_3761: Alcohol dehydrogenase, iron-containing	* Shewanella baltica OS155 Site: position = -104 score = 5.8785 sequence = TTAGACGACTGGTCTACTAA Gene: Sbal_0271: Alcohol dehydrogenase, iron-containing	Shewanella denitrificans OS217 Gene: Sden_1715: Alcohol dehydrogenase, iron-containing	2 Shewanella frigidimarina NCIMB 400 Gene: Sfri_2033: Alcohol dehydrogenase, iron-containing Gene: Sfri_0073: Alcohol dehydrogenase, iron-containing	Shewanella amazonensis SB2B	Shewanella loihica PV-4 Gene: Shew_0070: Alcohol dehydrogenase, iron-containing	Shewanella pealeana ATCC 700345 Gene: Spea_3925: Alcohol dehydrogenase, iron-containing	Shewanella halifaxensis HAW-EB4 Gene: Shal_0346: Alcohol dehydrogenase, iron-containing	* Shewanella piezotolerans WP3 Site: position = -62 score = 5.99367 sequence = CTAGACGACTGGTCTACTAA Gene: swp_0256: Alcohol dehydrogenase, iron-containing	* Shewanella sediminis HAW-EB3 Site: position = -59 score = 5.99367 sequence = CTAGACGACTGGTCTACTAA Gene: Ssed_0286: Alcohol dehydrogenase, iron-containing	Shewanella woodyi ATCC 51908	Alcohol dehydrogenase, iron-containing
Sbal_0270	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32 Gene: Sputcn32_0376: ThiJ/PfpI family protein	Shewanella sp W3-18-1 Gene: Sputw3181_0226: ThiJ/PfpI family protein	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155 Gene: Sbal_0270: ThiJ/PfpI family protein	Shewanella denitrificans OS217 Gene: Sden_1386: ThiJ/PfpI family protein	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0805: ThiJ/PfpI family protein	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345 Gene: Spea_3926: ThiJ/PfpI family protein	Shewanella halifaxensis HAW-EB4 Gene: Shal_0345: ThiJ/PfpI family protein	Shewanella piezotolerans WP3 Gene: swp_0255: ThiJ/PfpI family protein	Shewanella sediminis HAW-EB3 Gene: Ssed_0285: ThiJ/PfpI family protein	Shewanella woodyi ATCC 51908	ThiJ/PfpI family protein
Sbal_0269	Shewanella oneidensis MR-1	2 Shewanella putrefaciens CN-32 Gene: Sputcn32_0375: Glutathione S-transferase (EC 2.5.1.18) Gene: Sputcn32_0374: Glutathione S-transferase (EC 2.5.1.18)	2 Shewanella sp W3-18-1 Gene: Sputw3181_0224: Glutathione S-transferase (EC 2.5.1.18) Gene: Sputw3181_0225: Glutathione S-transferase (EC 2.5.1.18)	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155 Gene: Sbal_0269: Glutathione S-transferase (EC 2.5.1.18)	Shewanella denitrificans OS217 Gene: Sden_1385: Glutathione S-transferase (EC 2.5.1.18)	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0806: Glutathione S-transferase (EC 2.5.1.18)	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3 Gene: swp_0254: Glutathione S-transferase (EC 2.5.1.18)	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	Glutathione S-transferase (EC 2.5.1.18)
Sden_1387	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	* Shewanella denitrificans OS217 Site: position = -31 score = 5.85637 sequence = CTAGACGACCGGTCTATTAA Gene: Sden_1387: Putative oxidoreductase YncB	Shewanella frigidimarina NCIMB 400 Gene: Sfri_0804: Putative oxidoreductase YncB	* Shewanella amazonensis SB2B Site: position = -37 score = 5.61217 sequence = CTAGACGACTGGTCTAATTT Gene: Sama_0475: Putative oxidoreductase YncB	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	Putative oxidoreductase YncB

CRON 2.
SO4468	* Shewanella oneidensis MR-1 Site: position = -38 score = 5.61217 sequence = CTAGACGACTGGTCTAATTT Gene: SO_4468: Transcriptional regulator, TetR family	* Shewanella putrefaciens CN-32 Site: position = -25 score = 5.71724 sequence = CTAGACGACCGGTCTAATTT Gene: Sputcn32_0378: Transcriptional regulator, TetR family	* Shewanella sp W3-18-1 Site: position = -25 score = 5.71724 sequence = CTAGACGACCGGTCTAATTT Gene: Sputw3181_0228: Transcriptional regulator, TetR family	* Shewanella sp ANA-3 Site: position = -38 score = 5.79462 sequence = CTAGACGACTGGTCTAATAT Gene: Shewana3_0262: Transcriptional regulator, TetR family	* Shewanella sp MR-4 Site: position = -38 score = 5.61217 sequence = CTAGACGACTGGTCTAATTT Gene: Shewmr4_0261: Transcriptional regulator, TetR family	* Shewanella sp MR-7 Site: position = -38 score = 5.61217 sequence = CTAGACGACTGGTCTAATTT Gene: Shewmr7_3760: Transcriptional regulator, TetR family	* Shewanella baltica OS155 Site: position = -37 score = 5.64793 sequence = CTAGACGACCGGTCTATTTT Gene: Sbal_0272: Transcriptional regulator, TetR family	* Shewanella denitrificans OS217 Site: position = -36 score = 5.85839 sequence = CTAGACGACCGGTCTAATTG Gene: Sden_1388: Transcriptional regulator, TetR family	Shewanella frigidimarina NCIMB 400	* Shewanella amazonensis SB2B Site: position = -37 score = 5.63364 sequence = CTAGACGACTGGTCTAATCG Gene: Sama_0476: Transcriptional regulator, TetR family	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	* Shewanella piezotolerans WP3 Site: position = -37 score = 5.56764 sequence = CTAGACGACCGGTCTAATAC Gene: swp_0257: Transcriptional regulator, TetR family	* Shewanella sediminis HAW-EB3 Site: position = -36 score = 5.52826 sequence = CTAGACGACCGGTCTATTCT Gene: Ssed_0287: Transcriptional regulator, TetR family	Shewanella woodyi ATCC 51908	Transcriptional regulator, TetR family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog SO4468 - Shewanellaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --