Regulon of SO4468 in Shewanella sp MR-4

Properties
Regulator type:	Transcription factor
TF locus tag:	Shewmr4_0261
Regulator family:	TetR
Regulation mode:	repressor
Biological process:
Effector:
Regulog:	SO4468 - Shewanellaceae
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - TetR

Regulated operons
	Locus Tag	Name	Function
Position: -38 Score: 5.6 Sequence: CTAGACGACTGGTCTAATTT Locus tag: Shewmr4_0261 Name: SO4468 Funciton: Transcriptional regulator, TetR family
	Shewmr4_0261	SO4468	Transcriptional regulator, TetR family
Position: -51 Score: 6 Sequence: CTAGACGACTGGTCTACTAA Locus tag: Shewmr4_0260 Name: SO4469 Funciton: Alcohol dehydrogenase, iron-containing
	Shewmr4_0260	SO4469	Alcohol dehydrogenase, iron-containing

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD