Regulon of SO4468 in Shewanella sp W3-18-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Sputw3181_0228
Regulator family:	TetR
Regulation mode:	repressor
Biological process:
Effector:
Regulog:	SO4468 - Shewanellaceae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - TetR

Regulated operons
	Locus Tag	Name	Function
Position: -25 Score: 5.7 Sequence: CTAGACGACCGGTCTAATTT Locus tag: Sputw3181_0228 Name: SO4468 Funciton: Transcriptional regulator, TetR family
	Sputw3181_0228	SO4468	Transcriptional regulator, TetR family
Position: -64 Score: 5.9 Sequence: TTAGACGACTGGTCTACTAA Locus tag: Sputw3181_0227 Name: SO4469 Funciton: Alcohol dehydrogenase, iron-containing Locus tag: Sputw3181_0226 Name: Sbal_0270 Funciton: ThiJ/PfpI family protein Locus tag: Sputw3181_0225 Name: Sbal_0269 Funciton: Glutathione S-transferase (EC 2.5.1.18) Locus tag: Sputw3181_0224 Name: Sbal_0269 Funciton: Glutathione S-transferase (EC 2.5.1.18)
	Sputw3181_0227	SO4469	Alcohol dehydrogenase, iron-containing
	Sputw3181_0226	Sbal_0270	ThiJ/PfpI family protein
	Sputw3181_0225	Sbal_0269	Glutathione S-transferase (EC 2.5.1.18)
	Sputw3181_0224	Sbal_0269	Glutathione S-transferase (EC 2.5.1.18)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD