Regulon of SO4468 in Shewanella denitrificans OS217

Properties
Regulator type:	Transcription factor
TF locus tag:	Sden_1388
Regulator family:	TetR
Regulation mode:	repressor
Biological process:
Effector:
Regulog:	SO4468 - Shewanellaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - TetR

Regulated operons
	Locus Tag	Name	Function
Position: -36 Score: 5.9 Sequence: CTAGACGACCGGTCTAATTG Locus tag: Sden_1388 Name: SO4468 Funciton: Transcriptional regulator, TetR family
	Sden_1388	SO4468	Transcriptional regulator, TetR family
Position: -31 Score: 5.9 Sequence: CTAGACGACCGGTCTATTAA Locus tag: Sden_1387 Name: Sden_1387 Funciton: Putative oxidoreductase YncB Locus tag: Sden_1386 Name: Sbal_0270 Funciton: ThiJ/PfpI family protein Locus tag: Sden_1385 Name: Sbal_0269 Funciton: Glutathione S-transferase (EC 2.5.1.18)
	Sden_1387	Sden_1387	Putative oxidoreductase YncB
	Sden_1386	Sbal_0270	ThiJ/PfpI family protein
	Sden_1385	Sbal_0269	Glutathione S-transferase (EC 2.5.1.18)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD