Regulon of SO4468 in Shewanella sediminis HAW-EB3

Properties
Regulator type:	Transcription factor
TF locus tag:	Ssed_0287
Regulator family:	TetR
Regulation mode:	repressor
Biological process:
Effector:
Regulog:	SO4468 - Shewanellaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - TetR

Regulated operons
	Locus Tag	Name	Function
Position: -59 Score: 6 Sequence: CTAGACGACTGGTCTACTAA Locus tag: Ssed_0286 Name: SO4469 Funciton: Alcohol dehydrogenase, iron-containing Locus tag: Ssed_0285 Name: Sbal_0270 Funciton: ThiJ/PfpI family protein
	Ssed_0286	SO4469	Alcohol dehydrogenase, iron-containing
	Ssed_0285	Sbal_0270	ThiJ/PfpI family protein
Position: -36 Score: 5.5 Sequence: CTAGACGACCGGTCTATTCT Locus tag: Ssed_0287 Name: SO4468 Funciton: Transcriptional regulator, TetR family
	Ssed_0287	SO4468	Transcriptional regulator, TetR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD