Regulon of SO4468 in Shewanella amazonensis SB2B

Properties
Regulator type:	Transcription factor
TF locus tag:	Sama_0476
Regulator family:	TetR
Regulation mode:	repressor
Biological process:
Effector:
Regulog:	SO4468 - Shewanellaceae
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - TetR

Regulated operons
	Locus Tag	Name	Function
Position: -37 Score: 5.6 Sequence: CTAGACGACTGGTCTAATTT Locus tag: Sama_0475 Name: Sden_1387 Funciton: Putative oxidoreductase YncB
	Sama_0475	Sden_1387	Putative oxidoreductase YncB
Position: -37 Score: 5.6 Sequence: CTAGACGACTGGTCTAATCG Locus tag: Sama_0476 Name: SO4468 Funciton: Transcriptional regulator, TetR family
	Sama_0476	SO4468	Transcriptional regulator, TetR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD