Orthologous regulated operons containing Sbal_0270 gene

Properties
Regulog:	SO4468 - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:
Effector:
Phylum:	Proteobacteria/gamma

Built upon 22 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Shewanella baltica OS155
Position: -104 Score: 5.8785 Sequence: TTAGACGACTGGTCTACTAA Locus tag: Sbal_0271 Name: SO4469 Funciton: Alcohol dehydrogenase, iron-containing Locus tag: Sbal_0270 Name: Sbal_0270 Funciton: ThiJ/PfpI family protein Locus tag: Sbal_0269 Name: Sbal_0269 Funciton: Glutathione S-transferase (EC 2.5.1.18)
SO4469-Sbal_0270-Sbal_0269	-104	5.9	TTAGACGACTGGTCTACTAA	Sbal_0271
Shewanella denitrificans OS217
Position: -31 Score: 5.85637 Sequence: CTAGACGACCGGTCTATTAA Locus tag: Sden_1387 Name: Sden_1387 Funciton: Putative oxidoreductase YncB Locus tag: Sden_1386 Name: Sbal_0270 Funciton: ThiJ/PfpI family protein Locus tag: Sden_1385 Name: Sbal_0269 Funciton: Glutathione S-transferase (EC 2.5.1.18)
Sden_1387-Sbal_0270-Sbal_0269	-31	5.9	CTAGACGACCGGTCTATTAA	Sden_1387
Shewanella piezotolerans WP3
Position: -62 Score: 5.99367 Sequence: CTAGACGACTGGTCTACTAA Locus tag: swp_0256 Name: SO4469 Funciton: Alcohol dehydrogenase, iron-containing Locus tag: swp_0255 Name: Sbal_0270 Funciton: ThiJ/PfpI family protein Locus tag: swp_0254 Name: Sbal_0269 Funciton: Glutathione S-transferase (EC 2.5.1.18)
SO4469-Sbal_0270-Sbal_0269	-62	6	CTAGACGACTGGTCTACTAA	swp_0256
Shewanella putrefaciens CN-32
Position: -64 Score: 5.8785 Sequence: TTAGACGACTGGTCTACTAA Locus tag: Sputcn32_0377 Name: SO4469 Funciton: Alcohol dehydrogenase, iron-containing Locus tag: Sputcn32_0376 Name: Sbal_0270 Funciton: ThiJ/PfpI family protein Locus tag: Sputcn32_0375 Name: Sbal_0269 Funciton: Glutathione S-transferase (EC 2.5.1.18) Locus tag: Sputcn32_0374 Name: Sbal_0269 Funciton: Glutathione S-transferase (EC 2.5.1.18)
SO4469-Sbal_0270-Sbal_0269 -Sbal_0269	-64	5.9	TTAGACGACTGGTCTACTAA	Sputcn32_0377
Shewanella sediminis HAW-EB3
Position: -59 Score: 5.99367 Sequence: CTAGACGACTGGTCTACTAA Locus tag: Ssed_0286 Name: SO4469 Funciton: Alcohol dehydrogenase, iron-containing Locus tag: Ssed_0285 Name: Sbal_0270 Funciton: ThiJ/PfpI family protein
SO4469-Sbal_0270	-59	6	CTAGACGACTGGTCTACTAA	Ssed_0286
Shewanella sp W3-18-1
Position: -64 Score: 5.8785 Sequence: TTAGACGACTGGTCTACTAA Locus tag: Sputw3181_0227 Name: SO4469 Funciton: Alcohol dehydrogenase, iron-containing Locus tag: Sputw3181_0226 Name: Sbal_0270 Funciton: ThiJ/PfpI family protein Locus tag: Sputw3181_0225 Name: Sbal_0269 Funciton: Glutathione S-transferase (EC 2.5.1.18) Locus tag: Sputw3181_0224 Name: Sbal_0269 Funciton: Glutathione S-transferase (EC 2.5.1.18)
SO4469-Sbal_0270-Sbal_0269 -Sbal_0269	-64	5.9	TTAGACGACTGGTCTACTAA	Sputw3181_0227