Regulog MlnR - Various betaproteobacteria
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Malonate metabolism |
| Effector: | |
| Phylum: | Proteobacteria/Beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Various betaproteobacteria
- By TF family - GntR/Others
- By pathway - Malonate metabolism
| Genome | Genes | Operons |
|---|---|---|
| Methylobacillus flagellatus KT | ||
| Methylophilales bacterium HTCC2181 | ||
| Methylotenera mobilis JLW8 | ||
| Nitrosomonas europaea ATCC 19718 | ||
| Nitrosospira multiformis ATCC 25196 | ||
| Thiobacillus denitrificans | ||
| Azoarcus sp. EbN1 | 6 | 2 |
| Dechloromonas aromatica RCB | 12 | 6 |
| Thauera sp. MZ1T | 6 | 4 |
| Chromobacterium violaceum ATCC 12472 | ||
| Laribacter hongkongensis HLHK9 | ||
| Neisseria meningitidis MC58 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| mlnR |
|
|
|
|
|
|
*
Azoarcus sp. EbN1 Site: position = -74 score = 5.85352 sequence = TTATCCATAATTATGAGTGC Gene: ebA3736: Transcriptional regulator of malonate metabolism, GntR family |
*
Dechloromonas aromatica RCB Site: position = -29 score = 5.5987 sequence = GTATCCATAATTATGGAAGC Gene: Daro_4007: Transcriptional regulator of malonate metabolism, GntR family |
*
Thauera sp. MZ1T Site: position = -176 score = 6.31666 sequence = TTATCCATAATTATGAATGC Gene: Tmz1t_3487: Transcriptional regulator of malonate metabolism, GntR family |
|
|
|
Transcriptional regulator of malonate metabolism, GntR family |
| CRON 2. | |||||||||||||
| ebA7223 |
|
|
|
|
|
|
Gene: ebA7223: YhdH, a putative quinone oxidoreductase |
*
Dechloromonas aromatica RCB Site: position = -49 score = 5.96971 sequence = TCATTCGTAATTATGAATAC Gene: Daro_1202: YhdH, a putative quinone oxidoreductase |
*
Thauera sp. MZ1T Site: position = -64 score = 4.8576 sequence = GCGGCTATAATTATGAATCA Gene: Tmz1t_1612: YhdH, a putative quinone oxidoreductase |
|
|
|
YhdH, a putative quinone oxidoreductase |
| Daro_1330 |
|
|
|
|
|
|
|
2
Dechloromonas aromatica RCB Gene: Daro_1330: Two-component hybrid sensor and regulator Gene: Daro_1203: Two-component hybrid sensor and regulator |
Gene: Tmz1t_1613: Two-component hybrid sensor and regulator |
|
|
|
Two-component hybrid sensor and regulator |
| prpE |
|
|
|
|
|
|
Gene: ebA7220: Propionate-CoA ligase |
Gene: Daro_1204: Propionate-CoA ligase |
Gene: Tmz1t_1614: Propionate-CoA ligase |
|
Gene: LHK_02062: Propionate-CoA ligase |
|
Propionate-CoA ligase |
| CRON 3. | |||||||||||||
| epi |
|
|
|
|
Gene: Nmul_A0281: Methylmalonyl-CoA epimerase (EC 5.1.99.1) |
|
Gene: ebA3749: Methylmalonyl-CoA epimerase (EC 5.1.99.1) |
*
Dechloromonas aromatica RCB Site: position = -50 score = 4.75095 sequence = ATCCCTATAATTATGGATTA Gene: Daro_0300: Methylmalonyl-CoA epimerase (EC 5.1.99.1) |
*
Thauera sp. MZ1T Site: position = -49 score = 5.70978 sequence = TCCTCTATAATTATGAATTC Gene: Tmz1t_1139: Methylmalonyl-CoA epimerase (EC 5.1.99.1) |
Gene: CV3928: Methylmalonyl-CoA epimerase (EC 5.1.99.1) |
|
|
Methylmalonyl-CoA epimerase (EC 5.1.99.1) |
| CRON 4. | |||||||||||||
| ebA3691 |
|
|
|
|
|
|
Gene: ebA3691: Enoyl-CoA hydratase (EC 4.2.1.17) |
*
Dechloromonas aromatica RCB Site: position = -113 score = 4.29429 sequence = TAATTAATAATTACCGTAAA Site: position = -120 score = 4.66108 sequence = TCCTCCCTAATTAATAATTA Gene: Daro_4012: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: Tmz1t_3491: Enoyl-CoA hydratase (EC 4.2.1.17) |
|
|
|
Enoyl-CoA hydratase (EC 4.2.1.17) |
| CRON 5. | |||||||||||||
| mutB |
|
|
|
|
|
|
*
Azoarcus sp. EbN1 Site: position = -298 score = 5.85352 sequence = GCACTCATAATTATGGATAA Gene: ebA3738: Methylmalonyl-CoA mutase (EC 5.4.99.2) |
*
Dechloromonas aromatica RCB Site: position = -121 score = 5.5987 sequence = GCTTCCATAATTATGGATAC Gene: Daro_4006: Methylmalonyl-CoA mutase (EC 5.4.99.2) |
*
Thauera sp. MZ1T Site: position = -254 score = 6.31666 sequence = GCATTCATAATTATGGATAA Gene: Tmz1t_3486: Methylmalonyl-CoA mutase (EC 5.4.99.2) |
|
|
|
Methylmalonyl-CoA mutase (EC 5.4.99.2) |
| ebA3739 |
|
|
|
|
|
|
Gene: ebA3739: hypothetical protein |
|
|
|
|
|
hypothetical protein |
| meaB |
|
|
|
|
|
|
Gene: ebA3741: auxiliary metallochaperone, involved in the protection and assembly of methylmalonyl-CoA mutase |
Gene: Daro_4005: auxiliary metallochaperone, involved in the protection and assembly of methylmalonyl-CoA mutase |
Gene: Tmz1t_3485: auxiliary metallochaperone, involved in the protection and assembly of methylmalonyl-CoA mutase |
|
|
|
auxiliary metallochaperone, involved in the protection and assembly of methylmalonyl-CoA mutase |
| pccB |
|
|
|
|
|
|
Gene: ebA3742: Propionyl-CoA carboxylase carboxyl transferase subunit (EC 6.4.1.3) |
Gene: Daro_4004: Propionyl-CoA carboxylase carboxyl transferase subunit (EC 6.4.1.3) |
Gene: Tmz1t_3484: Propionyl-CoA carboxylase carboxyl transferase subunit (EC 6.4.1.3) |
|
|
|
Propionyl-CoA carboxylase carboxyl transferase subunit (EC 6.4.1.3) |
| pccA |
|
|
|
|
|
|
2
Azoarcus sp. EbN1 Gene: ebA3743: Propionyl-CoA carboxylase, alpha subunit Gene: ebA5667: Propionyl-CoA carboxylase, alpha subunit |
Gene: Daro_4003: Propionyl-CoA carboxylase, alpha subunit |
Gene: Tmz1t_3483: Propionyl-CoA carboxylase, alpha subunit |
|
|
|
Propionyl-CoA carboxylase, alpha subunit |
| CRON 6. | |||||||||||||
| Daro_4011 |
|
|
|
|
|
|
|
*
Dechloromonas aromatica RCB Site: position = -26 score = 4.66108 sequence = TAATTATTAATTAGGGAGGA Site: position = -33 score = 4.29429 sequence = TTTACGGTAATTATTAATTA Gene: Daro_4011: Putative membrane protein, clustering with ActP |
Gene: Tmz1t_3490: Putative membrane protein, clustering with ActP |
|
Gene: LHK_01261: Putative membrane protein, clustering with ActP |
|
Putative membrane protein, clustering with ActP |
| actP |
|
|
|
|
|
|
Gene: ebA3695: Acetate permease ActP (cation/acetate symporter) |
Gene: Daro_4010: Acetate permease ActP (cation/acetate symporter) |
Gene: Tmz1t_3489: Acetate permease ActP (cation/acetate symporter) |
|
Gene: LHK_01260: Acetate permease ActP (cation/acetate symporter) |
|
Acetate permease ActP (cation/acetate symporter) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |