Regulon of MlnR in Azoarcus sp. EbN1

Properties
Regulator type:	Transcription factor
TF locus tag:	ebA3736
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Malonate metabolism
Effector:
Regulog:	MlnR - Various betaproteobacteria
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Various betaproteobacteria
By TF family - GntR/Others
By pathway - Malonate metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -298 Score: 5.9 Sequence: GCACTCATAATTATGGATAA Locus tag: ebA3738 Name: mutB Funciton: Methylmalonyl-CoA mutase (EC 5.4.99.2) Locus tag: ebA3739 Name: ebA3739 Funciton: hypothetical protein Locus tag: ebA3741 Name: meaB Funciton: auxiliary metallochaperone, involved in the protection and assembly of methylmalonyl-CoA mutase Locus tag: ebA3742 Name: pccB Funciton: Propionyl-CoA carboxylase carboxyl transferase subunit (EC 6.4.1.3) Locus tag: ebA3743 Name: pccA Funciton: Propionyl-CoA carboxylase, alpha subunit
	ebA3738	mutB	Methylmalonyl-CoA mutase (EC 5.4.99.2)
	ebA3739	ebA3739	hypothetical protein
	ebA3741	meaB	auxiliary metallochaperone, involved in the protection and assembly of methylmalonyl-CoA mutase
	ebA3742	pccB	Propionyl-CoA carboxylase carboxyl transferase subunit (EC 6.4.1.3)
	ebA3743	pccA	Propionyl-CoA carboxylase, alpha subunit
Position: -74 Score: 5.9 Sequence: TTATCCATAATTATGAGTGC Locus tag: ebA3736 Name: mlnR Funciton: Transcriptional regulator of malonate metabolism, GntR family
	ebA3736	mlnR	Transcriptional regulator of malonate metabolism, GntR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD