Regulon of MlnR in Thauera sp. MZ1T

Properties
Regulator type:	Transcription factor
TF locus tag:	Tmz1t_3487
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Malonate metabolism
Effector:
Regulog:	MlnR - Various betaproteobacteria
Statistics of regulated genes:
- Genes	6
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Various betaproteobacteria
By TF family - GntR/Others
By pathway - Malonate metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -254 Score: 6.3 Sequence: GCATTCATAATTATGGATAA Locus tag: Tmz1t_3486 Name: mutB Funciton: Methylmalonyl-CoA mutase (EC 5.4.99.2)
	Tmz1t_3486	mutB	Methylmalonyl-CoA mutase (EC 5.4.99.2)
Position: -49 Score: 5.7 Sequence: TCCTCTATAATTATGAATTC Locus tag: Tmz1t_1139 Name: epi Funciton: Methylmalonyl-CoA epimerase (EC 5.1.99.1)
	Tmz1t_1139	epi	Methylmalonyl-CoA epimerase (EC 5.1.99.1)
Position: -64 Score: 4.9 Sequence: GCGGCTATAATTATGAATCA Locus tag: Tmz1t_1612 Name: ebA7223 Funciton: YhdH, a putative quinone oxidoreductase Locus tag: Tmz1t_1613 Name: Daro_1330 Funciton: Two-component hybrid sensor and regulator Locus tag: Tmz1t_1614 Name: prpE Funciton: Propionate-CoA ligase
	Tmz1t_1612	ebA7223	YhdH, a putative quinone oxidoreductase
	Tmz1t_1613	Daro_1330	Two-component hybrid sensor and regulator
	Tmz1t_1614	prpE	Propionate-CoA ligase
Position: -176 Score: 6.3 Sequence: TTATCCATAATTATGAATGC Locus tag: Tmz1t_3487 Name: mlnR Funciton: Transcriptional regulator of malonate metabolism, GntR family
	Tmz1t_3487	mlnR	Transcriptional regulator of malonate metabolism, GntR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD