Orthologous regulated operons containing meaB gene

Properties
Regulog:	MlnR - Various betaproteobacteria
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Malonate metabolism
Effector:
Phylum:	Proteobacteria/Beta

Built upon 14 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Azoarcus sp. EbN1
Position: -298 Score: 5.85352 Sequence: GCACTCATAATTATGGATAA Locus tag: ebA3738 Name: mutB Funciton: Methylmalonyl-CoA mutase (EC 5.4.99.2) Locus tag: ebA3739 Name: ebA3739 Funciton: hypothetical protein Locus tag: ebA3741 Name: meaB Funciton: auxiliary metallochaperone, involved in the protection and assembly of methylmalonyl-CoA mutase Locus tag: ebA3742 Name: pccB Funciton: Propionyl-CoA carboxylase carboxyl transferase subunit (EC 6.4.1.3) Locus tag: ebA3743 Name: pccA Funciton: Propionyl-CoA carboxylase, alpha subunit
mutB-ebA3739-meaB-pccB-pccA	-298	5.9	GCACTCATAATTATGGATAA	ebA3738
Dechloromonas aromatica RCB
Position: -121 Score: 5.5987 Sequence: GCTTCCATAATTATGGATAC Locus tag: Daro_4006 Name: mutB Funciton: Methylmalonyl-CoA mutase (EC 5.4.99.2) Locus tag: Daro_4005 Name: meaB Funciton: auxiliary metallochaperone, involved in the protection and assembly of methylmalonyl-CoA mutase Locus tag: Daro_4004 Name: pccB Funciton: Propionyl-CoA carboxylase carboxyl transferase subunit (EC 6.4.1.3) Locus tag: Daro_4003 Name: pccA Funciton: Propionyl-CoA carboxylase, alpha subunit
mutB-meaB-pccB-pccA	-121	5.6	GCTTCCATAATTATGGATAC	Daro_4006

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --