Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing ebA3739 gene

Properties
Regulog: MlnR - Various betaproteobacteria
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Malonate metabolism
Effector:
Phylum: Proteobacteria/Beta
Built upon 14 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Azoarcus sp. EbN1
Position: -298
Score: 5.85352
Sequence: GCACTCATAATTATGGATAA
Locus tag: ebA3738
Name: mutB
Funciton: Methylmalonyl-CoA mutase (EC 5.4.99.2)
Locus tag: ebA3739
Name: ebA3739
Funciton: hypothetical protein
Locus tag: ebA3741
Name: meaB
Funciton: auxiliary metallochaperone, involved in the protection and assembly of methylmalonyl-CoA mutase
Locus tag: ebA3742
Name: pccB
Funciton: Propionyl-CoA carboxylase carboxyl transferase subunit (EC 6.4.1.3)
Locus tag: ebA3743
Name: pccA
Funciton: Propionyl-CoA carboxylase, alpha subunit
mutB-ebA3739-meaB-pccB-pccA -298 5.9 GCACTCATAATTATGGATAA ebA3738