Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Daro_1330 gene

Properties
Regulog: MlnR - Various betaproteobacteria
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Malonate metabolism
Effector:
Phylum: Proteobacteria/Beta
Built upon 14 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Dechloromonas aromatica RCB
Position: -49
Score: 5.96971
Sequence: TCATTCGTAATTATGAATAC
Locus tag: Daro_1202
Name: ebA7223
Funciton: YhdH, a putative quinone oxidoreductase
Locus tag: Daro_1203
Name: Daro_1330
Funciton: Two-component hybrid sensor and regulator
Locus tag: Daro_1204
Name: prpE
Funciton: Propionate-CoA ligase
ebA7223-Daro_1330-prpE -49 6 TCATTCGTAATTATGAATAC Daro_1202
Thauera sp. MZ1T
Position: -64
Score: 4.8576
Sequence: GCGGCTATAATTATGAATCA
Locus tag: Tmz1t_1612
Name: ebA7223
Funciton: YhdH, a putative quinone oxidoreductase
Locus tag: Tmz1t_1613
Name: Daro_1330
Funciton: Two-component hybrid sensor and regulator
Locus tag: Tmz1t_1614
Name: prpE
Funciton: Propionate-CoA ligase
ebA7223-Daro_1330-prpE -64 4.9 GCGGCTATAATTATGAATCA Tmz1t_1612