Regulon of MlnR in Dechloromonas aromatica RCB

Properties
Regulator type:	Transcription factor
TF locus tag:	Daro_4007
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Malonate metabolism
Effector:
Regulog:	MlnR - Various betaproteobacteria
Statistics of regulated genes:
- Genes	12
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Various betaproteobacteria
By TF family - GntR/Others
By pathway - Malonate metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -121 Score: 5.6 Sequence: GCTTCCATAATTATGGATAC Locus tag: Daro_4006 Name: mutB Funciton: Methylmalonyl-CoA mutase (EC 5.4.99.2) Locus tag: Daro_4005 Name: meaB Funciton: auxiliary metallochaperone, involved in the protection and assembly of methylmalonyl-CoA mutase Locus tag: Daro_4004 Name: pccB Funciton: Propionyl-CoA carboxylase carboxyl transferase subunit (EC 6.4.1.3) Locus tag: Daro_4003 Name: pccA Funciton: Propionyl-CoA carboxylase, alpha subunit
	Daro_4006	mutB	Methylmalonyl-CoA mutase (EC 5.4.99.2)
	Daro_4005	meaB	auxiliary metallochaperone, involved in the protection and assembly of methylmalonyl-CoA mutase
	Daro_4004	pccB	Propionyl-CoA carboxylase carboxyl transferase subunit (EC 6.4.1.3)
	Daro_4003	pccA	Propionyl-CoA carboxylase, alpha subunit
Position: -50 Score: 4.8 Sequence: ATCCCTATAATTATGGATTA Locus tag: Daro_0300 Name: epi Funciton: Methylmalonyl-CoA epimerase (EC 5.1.99.1)
	Daro_0300	epi	Methylmalonyl-CoA epimerase (EC 5.1.99.1)
Position: -49 Score: 6 Sequence: TCATTCGTAATTATGAATAC Locus tag: Daro_1202 Name: ebA7223 Funciton: YhdH, a putative quinone oxidoreductase Locus tag: Daro_1203 Name: Daro_1330 Funciton: Two-component hybrid sensor and regulator Locus tag: Daro_1204 Name: prpE Funciton: Propionate-CoA ligase
	Daro_1202	ebA7223	YhdH, a putative quinone oxidoreductase
	Daro_1203	Daro_1330	Two-component hybrid sensor and regulator
	Daro_1204	prpE	Propionate-CoA ligase
Position: -120 Score: 4.7 Sequence: TCCTCCCTAATTAATAATTA Position: -113 Score: 4.3 Sequence: TAATTAATAATTACCGTAAA Locus tag: Daro_4012 Name: ebA3691 Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
	Daro_4012	ebA3691	Enoyl-CoA hydratase (EC 4.2.1.17)
Position: -33 Score: 4.3 Sequence: TTTACGGTAATTATTAATTA Position: -26 Score: 4.7 Sequence: TAATTATTAATTAGGGAGGA Locus tag: Daro_4011 Name: Daro_4011 Funciton: Putative membrane protein, clustering with ActP Locus tag: Daro_4010 Name: actP Funciton: Acetate permease ActP (cation/acetate symporter)
	Daro_4011	Daro_4011	Putative membrane protein, clustering with ActP
	Daro_4010	actP	Acetate permease ActP (cation/acetate symporter)
Position: -29 Score: 5.6 Sequence: GTATCCATAATTATGGAAGC Locus tag: Daro_4007 Name: mlnR Funciton: Transcriptional regulator of malonate metabolism, GntR family
	Daro_4007	mlnR	Transcriptional regulator of malonate metabolism, GntR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD