Regulog YhcF - Lactobacillaceae

Properties
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Statistics of regulated genes
Genome	Genes	Operons
Lactobacillus acidophilus NCFM	7	2
Lactobacillus brevis ATCC 367	3	1
Lactobacillus casei ATCC 334	3	1
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	7	3
Lactobacillus fermentum IFO 3956
Lactobacillus helveticus DPC 4571	7	2
Lactobacillus johnsonii NCC 533	6	2
Lactobacillus plantarum WCFS1	3	1
Lactobacillus reuteri JCM 1112
Lactobacillus rhamnosus GG	3	1
Lactobacillus sakei subsp. sakei 23K
Lactobacillus salivarius subsp. salivarius UCC118
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
Oenococcus oeni PSU-1
Pediococcus pentosaceus ATCC 25745	3	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																Function

CRON 1.
ytsC	* Lactobacillus acidophilus NCFM Site: position = -59 score = 6.33012 sequence = AGTGTATTAATTAAATAATACAGT Gene: LBA1680: Putative antimicrobial peptide ABC exporter, ATP-binding subunit	Lactobacillus brevis ATCC 367 Gene: LVIS_0387: Putative antimicrobial peptide ABC exporter, ATP-binding subunit	Lactobacillus casei ATCC 334 Gene: LSEI_1994: Putative antimicrobial peptide ABC exporter, ATP-binding subunit	2 Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365* Site: position = -45 score = 4.37241 sequence = GGTGTATTACAACGGTAATACACC Gene: LBUL_0989: Putative antimicrobial peptide ABC exporter, ATP-binding subunit Site: position = -45 score = 4.37241 sequence = GGTGTATTACAACGGTAATACACC Gene: LBUL_1019: Putative antimicrobial peptide ABC exporter, ATP-binding subunit	Lactobacillus fermentum IFO 3956	* Lactobacillus helveticus DPC 4571 Site: position = -56 score = 5.46515 sequence = AGTGTATTGAGTTAATAATACAGT Gene: lhv_1774: Putative antimicrobial peptide ABC exporter, ATP-binding subunit	* Lactobacillus johnsonii NCC 533 Site: position = -45 score = 5.26872 sequence = AGTGTAACAGGTACGTAATACACT Gene: LJ0604: Putative antimicrobial peptide ABC exporter, ATP-binding subunit	Lactobacillus plantarum WCFS1 Gene: lp_2739: Putative antimicrobial peptide ABC exporter, ATP-binding subunit	Lactobacillus reuteri JCM 1112	Lactobacillus rhamnosus GG Gene: LGG_01986: Putative antimicrobial peptide ABC exporter, ATP-binding subunit	Lactobacillus sakei subsp. sakei 23K Gene: LSA0127: Putative antimicrobial peptide ABC exporter, ATP-binding subunit	Lactobacillus salivarius subsp. salivarius UCC118	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	Oenococcus oeni PSU-1	Pediococcus pentosaceus ATCC 25745 Gene: PEPE_1743: Putative antimicrobial peptide ABC exporter, ATP-binding subunit	Putative antimicrobial peptide ABC exporter, ATP-binding subunit
ytsB	Lactobacillus acidophilus NCFM Gene: LBA1679: ABC-type antimicrobial peptide transport system, permease component	Lactobacillus brevis ATCC 367 Gene: LVIS_0388: ABC-type antimicrobial peptide transport system, permease component	Lactobacillus casei ATCC 334 Gene: LSEI_1993: ABC-type antimicrobial peptide transport system, permease component	2 Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 Gene: LBUL_0990: ABC-type antimicrobial peptide transport system, permease component Gene: LBUL_1018: ABC-type antimicrobial peptide transport system, permease component	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571 Gene: lhv_1773: ABC-type antimicrobial peptide transport system, permease component	Lactobacillus johnsonii NCC 533 Gene: LJ0605: ABC-type antimicrobial peptide transport system, permease component	Lactobacillus plantarum WCFS1 Gene: lp_2740: ABC-type antimicrobial peptide transport system, permease component	Lactobacillus reuteri JCM 1112	Lactobacillus rhamnosus GG Gene: LGG_01985: ABC-type antimicrobial peptide transport system, permease component	Lactobacillus sakei subsp. sakei 23K Gene: LSA0128: ABC-type antimicrobial peptide transport system, permease component	Lactobacillus salivarius subsp. salivarius UCC118	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	Oenococcus oeni PSU-1	Pediococcus pentosaceus ATCC 25745 Gene: PEPE_1744: ABC-type antimicrobial peptide transport system, permease component	ABC-type antimicrobial peptide transport system, permease component

CRON 2.
yhcF	* Lactobacillus acidophilus NCFM Site: position = -43 score = 6.56192 sequence = ACTGTAATAGATAAATAATACAGT Gene: LBA1189: Transcriptional regulator, GntR family	* Lactobacillus brevis ATCC 367 Site: position = -39 score = 6.56286 sequence = AGTGTAATAGTAAAATATAACACT Gene: LVIS_2001: Transcriptional regulator, GntR family	* Lactobacillus casei ATCC 334 Site: position = -40 score = 6.91165 sequence = AGTGTATTAGTAATCTAATACACT Gene: LSEI_1880: Transcriptional regulator, GntR family	* Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 Site: position = -38 score = 6.41754 sequence = AGTGTATTAGGTAACTAGTACAGT Gene: LBUL_1563: Transcriptional regulator, GntR family	Lactobacillus fermentum IFO 3956	* Lactobacillus helveticus DPC 4571 Site: position = -44 score = 5.54546 sequence = AGTGTAATAGACATGTAATACAGC Gene: lhv_1290: Transcriptional regulator, GntR family	* Lactobacillus johnsonii NCC 533 Site: position = -42 score = 6.35666 sequence = AGTGTAATAGATAAACCGTACACT Gene: LJ1302: Transcriptional regulator, GntR family	* Lactobacillus plantarum WCFS1 Site: position = -39 score = 6.14523 sequence = ATTGTAATAGAAAAATAGAACACT Gene: lp_2615: Transcriptional regulator, GntR family	Lactobacillus reuteri JCM 1112	* Lactobacillus rhamnosus GG Site: position = -40 score = 6.63437 sequence = AGTGTAATAGATAGCTAATACACT Gene: LGG_01937: Transcriptional regulator, GntR family	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	Oenococcus oeni PSU-1	* Pediococcus pentosaceus ATCC 25745 Site: position = -37 score = 6.50758 sequence = AGTGTATTAGAAAACTAGTACACA Gene: PEPE_0054: Transcriptional regulator, GntR family	Transcriptional regulator, GntR family
yhcG	Lactobacillus acidophilus NCFM Gene: LBA1188: ABC-type multidrug transport system, ATPase component	Lactobacillus brevis ATCC 367 Gene: LVIS_2000: ABC-type multidrug transport system, ATPase component	Lactobacillus casei ATCC 334 Gene: LSEI_1881: ABC-type multidrug transport system, ATPase component	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 Gene: LBUL_1562: ABC-type multidrug transport system, ATPase component	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571 Gene: lhv_1289: ABC-type multidrug transport system, ATPase component	Lactobacillus johnsonii NCC 533 Gene: LJ1301: ABC-type multidrug transport system, ATPase component	Lactobacillus plantarum WCFS1 Gene: lp_2614: ABC-type multidrug transport system, ATPase component	Lactobacillus reuteri JCM 1112	Lactobacillus rhamnosus GG Gene: LGG_01938: ABC-type multidrug transport system, ATPase component	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	Oenococcus oeni PSU-1	Pediococcus pentosaceus ATCC 25745 Gene: PEPE_0053: ABC-type multidrug transport system, ATPase component	ABC-type multidrug transport system, ATPase component
yhcI	Lactobacillus acidophilus NCFM Gene: LBA1187: ABC-type multidrug transport system, permease component	Lactobacillus brevis ATCC 367 Gene: LVIS_1999: ABC-type multidrug transport system, permease component	Lactobacillus casei ATCC 334 Gene: LSEI_1882: ABC-type multidrug transport system, permease component	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 Gene: LBUL_1561: ABC-type multidrug transport system, permease component	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571 Gene: lhv_1288: ABC-type multidrug transport system, permease component	Lactobacillus johnsonii NCC 533 Gene: LJ1300: ABC-type multidrug transport system, permease component	Lactobacillus plantarum WCFS1 Gene: lp_2613: ABC-type multidrug transport system, permease component	Lactobacillus reuteri JCM 1112	Lactobacillus rhamnosus GG Gene: LGG_01939: ABC-type multidrug transport system, permease component	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	Oenococcus oeni PSU-1	Pediococcus pentosaceus ATCC 25745 Gene: PEPE_0052: ABC-type multidrug transport system, permease component	ABC-type multidrug transport system, permease component
yhcI2	Lactobacillus acidophilus NCFM Gene: LBA1186: ABC-type multidrug transport system, permease component	Lactobacillus brevis ATCC 367	Lactobacillus casei ATCC 334	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571 Gene: lhv_1287: ABC-type multidrug transport system, permease component	Lactobacillus johnsonii NCC 533 Gene: LJ1299: ABC-type multidrug transport system, permease component	Lactobacillus plantarum WCFS1	Lactobacillus reuteri JCM 1112	Lactobacillus rhamnosus GG	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	Oenococcus oeni PSU-1	Pediococcus pentosaceus ATCC 25745	ABC-type multidrug transport system, permease component
yhcI3	Lactobacillus acidophilus NCFM Gene: LBA1184: ABC-type multidrug transport system, permease component	Lactobacillus brevis ATCC 367	Lactobacillus casei ATCC 334	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571 Gene: lhv_1286: ABC-type multidrug transport system, permease component	Lactobacillus johnsonii NCC 533	Lactobacillus plantarum WCFS1	Lactobacillus reuteri JCM 1112	Lactobacillus rhamnosus GG	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	Oenococcus oeni PSU-1	Pediococcus pentosaceus ATCC 25745	ABC-type multidrug transport system, permease component

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog YhcF - Lactobacillaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --