Regulog YhcF - Lactobacillaceae
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Multidrug resistance; Multidrug efflux |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Lactobacillaceae
- By TF family - GntR/Others
- By pathway - Multidrug resistance
- By pathway - Multidrug efflux
| Genome | Genes | Operons |
|---|---|---|
| Lactobacillus acidophilus NCFM | 7 | 2 |
| Lactobacillus brevis ATCC 367 | 3 | 1 |
| Lactobacillus casei ATCC 334 | 3 | 1 |
| Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 | 7 | 3 |
| Lactobacillus fermentum IFO 3956 | ||
| Lactobacillus helveticus DPC 4571 | 7 | 2 |
| Lactobacillus johnsonii NCC 533 | 6 | 2 |
| Lactobacillus plantarum WCFS1 | 3 | 1 |
| Lactobacillus reuteri JCM 1112 | ||
| Lactobacillus rhamnosus GG | 3 | 1 |
| Lactobacillus sakei subsp. sakei 23K | ||
| Lactobacillus salivarius subsp. salivarius UCC118 | ||
| Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | ||
| Oenococcus oeni PSU-1 | ||
| Pediococcus pentosaceus ATCC 25745 | 3 | 1 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| ytsC |
*
Lactobacillus acidophilus NCFM Site: position = -59 score = 6.33012 sequence = AGTGTATTAATTAAATAATACAGT Gene: LBA1680: Putative antimicrobial peptide ABC exporter, ATP-binding subunit |
Gene: LVIS_0387: Putative antimicrobial peptide ABC exporter, ATP-binding subunit |
Gene: LSEI_1994: Putative antimicrobial peptide ABC exporter, ATP-binding subunit |
*2
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 Site: position = -45 score = 4.37241 sequence = GGTGTATTACAACGGTAATACACC Gene: LBUL_0989: Putative antimicrobial peptide ABC exporter, ATP-binding subunit Site: position = -45 score = 4.37241 sequence = GGTGTATTACAACGGTAATACACC Gene: LBUL_1019: Putative antimicrobial peptide ABC exporter, ATP-binding subunit |
|
*
Lactobacillus helveticus DPC 4571 Site: position = -56 score = 5.46515 sequence = AGTGTATTGAGTTAATAATACAGT Gene: lhv_1774: Putative antimicrobial peptide ABC exporter, ATP-binding subunit |
*
Lactobacillus johnsonii NCC 533 Site: position = -45 score = 5.26872 sequence = AGTGTAACAGGTACGTAATACACT Gene: LJ0604: Putative antimicrobial peptide ABC exporter, ATP-binding subunit |
Gene: lp_2739: Putative antimicrobial peptide ABC exporter, ATP-binding subunit |
|
Gene: LGG_01986: Putative antimicrobial peptide ABC exporter, ATP-binding subunit |
Gene: LSA0127: Putative antimicrobial peptide ABC exporter, ATP-binding subunit |
|
|
|
Gene: PEPE_1743: Putative antimicrobial peptide ABC exporter, ATP-binding subunit |
Putative antimicrobial peptide ABC exporter, ATP-binding subunit |
| ytsB |
Gene: LBA1679: ABC-type antimicrobial peptide transport system, permease component |
Gene: LVIS_0388: ABC-type antimicrobial peptide transport system, permease component |
Gene: LSEI_1993: ABC-type antimicrobial peptide transport system, permease component |
2
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 Gene: LBUL_0990: ABC-type antimicrobial peptide transport system, permease component Gene: LBUL_1018: ABC-type antimicrobial peptide transport system, permease component |
|
Gene: lhv_1773: ABC-type antimicrobial peptide transport system, permease component |
Gene: LJ0605: ABC-type antimicrobial peptide transport system, permease component |
Gene: lp_2740: ABC-type antimicrobial peptide transport system, permease component |
|
Gene: LGG_01985: ABC-type antimicrobial peptide transport system, permease component |
Gene: LSA0128: ABC-type antimicrobial peptide transport system, permease component |
|
|
|
Gene: PEPE_1744: ABC-type antimicrobial peptide transport system, permease component |
ABC-type antimicrobial peptide transport system, permease component |
| CRON 2. | ||||||||||||||||
| yhcF |
*
Lactobacillus acidophilus NCFM Site: position = -43 score = 6.56192 sequence = ACTGTAATAGATAAATAATACAGT Gene: LBA1189: Transcriptional regulator, GntR family |
*
Lactobacillus brevis ATCC 367 Site: position = -39 score = 6.56286 sequence = AGTGTAATAGTAAAATATAACACT Gene: LVIS_2001: Transcriptional regulator, GntR family |
*
Lactobacillus casei ATCC 334 Site: position = -40 score = 6.91165 sequence = AGTGTATTAGTAATCTAATACACT Gene: LSEI_1880: Transcriptional regulator, GntR family |
*
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 Site: position = -38 score = 6.41754 sequence = AGTGTATTAGGTAACTAGTACAGT Gene: LBUL_1563: Transcriptional regulator, GntR family |
|
*
Lactobacillus helveticus DPC 4571 Site: position = -44 score = 5.54546 sequence = AGTGTAATAGACATGTAATACAGC Gene: lhv_1290: Transcriptional regulator, GntR family |
*
Lactobacillus johnsonii NCC 533 Site: position = -42 score = 6.35666 sequence = AGTGTAATAGATAAACCGTACACT Gene: LJ1302: Transcriptional regulator, GntR family |
*
Lactobacillus plantarum WCFS1 Site: position = -39 score = 6.14523 sequence = ATTGTAATAGAAAAATAGAACACT Gene: lp_2615: Transcriptional regulator, GntR family |
|
*
Lactobacillus rhamnosus GG Site: position = -40 score = 6.63437 sequence = AGTGTAATAGATAGCTAATACACT Gene: LGG_01937: Transcriptional regulator, GntR family |
|
|
|
|
*
Pediococcus pentosaceus ATCC 25745 Site: position = -37 score = 6.50758 sequence = AGTGTATTAGAAAACTAGTACACA Gene: PEPE_0054: Transcriptional regulator, GntR family |
Transcriptional regulator, GntR family |
| yhcG |
Gene: LBA1188: ABC-type multidrug transport system, ATPase component |
Gene: LVIS_2000: ABC-type multidrug transport system, ATPase component |
Gene: LSEI_1881: ABC-type multidrug transport system, ATPase component |
Gene: LBUL_1562: ABC-type multidrug transport system, ATPase component |
|
Gene: lhv_1289: ABC-type multidrug transport system, ATPase component |
Gene: LJ1301: ABC-type multidrug transport system, ATPase component |
Gene: lp_2614: ABC-type multidrug transport system, ATPase component |
|
Gene: LGG_01938: ABC-type multidrug transport system, ATPase component |
|
|
|
|
Gene: PEPE_0053: ABC-type multidrug transport system, ATPase component |
ABC-type multidrug transport system, ATPase component |
| yhcI |
Gene: LBA1187: ABC-type multidrug transport system, permease component |
Gene: LVIS_1999: ABC-type multidrug transport system, permease component |
Gene: LSEI_1882: ABC-type multidrug transport system, permease component |
Gene: LBUL_1561: ABC-type multidrug transport system, permease component |
|
Gene: lhv_1288: ABC-type multidrug transport system, permease component |
Gene: LJ1300: ABC-type multidrug transport system, permease component |
Gene: lp_2613: ABC-type multidrug transport system, permease component |
|
Gene: LGG_01939: ABC-type multidrug transport system, permease component |
|
|
|
|
Gene: PEPE_0052: ABC-type multidrug transport system, permease component |
ABC-type multidrug transport system, permease component |
| yhcI2 |
Gene: LBA1186: ABC-type multidrug transport system, permease component |
|
|
|
|
Gene: lhv_1287: ABC-type multidrug transport system, permease component |
Gene: LJ1299: ABC-type multidrug transport system, permease component |
|
|
|
|
|
|
|
|
ABC-type multidrug transport system, permease component |
| yhcI3 |
Gene: LBA1184: ABC-type multidrug transport system, permease component |
|
|
|
|
Gene: lhv_1286: ABC-type multidrug transport system, permease component |
|
|
|
|
|
|
|
|
|
ABC-type multidrug transport system, permease component |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |