Regulon of YhcF in Pediococcus pentosaceus ATCC 25745

Properties
Regulator type:	Transcription factor
TF locus tag:	PEPE_0054
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	YhcF - Lactobacillaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -37 Score: 6.5 Sequence: AGTGTATTAGAAAACTAGTACACA Locus tag: PEPE_0054 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: PEPE_0053 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: PEPE_0052 Name: yhcI Funciton: ABC-type multidrug transport system, permease component
	PEPE_0054	yhcF	Transcriptional regulator, GntR family
	PEPE_0053	yhcG	ABC-type multidrug transport system, ATPase component
	PEPE_0052	yhcI	ABC-type multidrug transport system, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD