Regulon of YhcF in Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Properties
Regulator type:	Transcription factor
TF locus tag:	LBUL_1563
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	YhcF - Lactobacillaceae
Statistics of regulated genes:
- Genes	7
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -38 Score: 6.4 Sequence: AGTGTATTAGGTAACTAGTACAGT Locus tag: LBUL_1563 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: LBUL_1562 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: LBUL_1561 Name: yhcI Funciton: ABC-type multidrug transport system, permease component
	LBUL_1563	yhcF	Transcriptional regulator, GntR family
	LBUL_1562	yhcG	ABC-type multidrug transport system, ATPase component
	LBUL_1561	yhcI	ABC-type multidrug transport system, permease component
Position: -45 Score: 4.4 Sequence: GGTGTATTACAACGGTAATACACC Locus tag: LBUL_0989 Name: ytsC Funciton: Putative antimicrobial peptide ABC exporter, ATP-binding subunit Locus tag: LBUL_0990 Name: ytsB Funciton: ABC-type antimicrobial peptide transport system, permease component
	LBUL_0989	ytsC	Putative antimicrobial peptide ABC exporter, ATP-binding subunit
	LBUL_0990	ytsB	ABC-type antimicrobial peptide transport system, permease component
Position: -45 Score: 4.4 Sequence: GGTGTATTACAACGGTAATACACC Locus tag: LBUL_1019 Name: ytsC Funciton: Putative antimicrobial peptide ABC exporter, ATP-binding subunit Locus tag: LBUL_1018 Name: ytsB Funciton: ABC-type antimicrobial peptide transport system, permease component
	LBUL_1019	ytsC	Putative antimicrobial peptide ABC exporter, ATP-binding subunit
	LBUL_1018	ytsB	ABC-type antimicrobial peptide transport system, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD