Regulon of YhcF in Lactobacillus johnsonii NCC 533

Properties
Regulator type:	Transcription factor
TF locus tag:	LJ1302
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	YhcF - Lactobacillaceae
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -45 Score: 5.3 Sequence: AGTGTAACAGGTACGTAATACACT Locus tag: LJ0604 Name: ytsC Funciton: Putative antimicrobial peptide ABC exporter, ATP-binding subunit Locus tag: LJ0605 Name: ytsB Funciton: ABC-type antimicrobial peptide transport system, permease component
	LJ0604	ytsC	Putative antimicrobial peptide ABC exporter, ATP-binding subunit
	LJ0605	ytsB	ABC-type antimicrobial peptide transport system, permease component
Position: -42 Score: 6.4 Sequence: AGTGTAATAGATAAACCGTACACT Locus tag: LJ1302 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: LJ1301 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: LJ1300 Name: yhcI Funciton: ABC-type multidrug transport system, permease component Locus tag: LJ1299 Name: yhcI2 Funciton: ABC-type multidrug transport system, permease component
	LJ1302	yhcF	Transcriptional regulator, GntR family
	LJ1301	yhcG	ABC-type multidrug transport system, ATPase component
	LJ1300	yhcI	ABC-type multidrug transport system, permease component
	LJ1299	yhcI2	ABC-type multidrug transport system, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD