Regulon of YhcF in Lactobacillus plantarum WCFS1

Properties
Regulator type:	Transcription factor
TF locus tag:	lp_2615
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	YhcF - Lactobacillaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -39 Score: 6.1 Sequence: ATTGTAATAGAAAAATAGAACACT Locus tag: lp_2615 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: lp_2614 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: lp_2613 Name: yhcI Funciton: ABC-type multidrug transport system, permease component
	lp_2615	yhcF	Transcriptional regulator, GntR family
	lp_2614	yhcG	ABC-type multidrug transport system, ATPase component
	lp_2613	yhcI	ABC-type multidrug transport system, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD