Regulon of YhcF in Lactobacillus helveticus DPC 4571

Properties
Regulator type:	Transcription factor
TF locus tag:	lhv_1290
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	YhcF - Lactobacillaceae
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -44 Score: 5.5 Sequence: AGTGTAATAGACATGTAATACAGC Locus tag: lhv_1290 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: lhv_1289 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: lhv_1288 Name: yhcI Funciton: ABC-type multidrug transport system, permease component Locus tag: lhv_1287 Name: yhcI2 Funciton: ABC-type multidrug transport system, permease component Locus tag: lhv_1286 Name: yhcI3 Funciton: ABC-type multidrug transport system, permease component
	lhv_1290	yhcF	Transcriptional regulator, GntR family
	lhv_1289	yhcG	ABC-type multidrug transport system, ATPase component
	lhv_1288	yhcI	ABC-type multidrug transport system, permease component
	lhv_1287	yhcI2	ABC-type multidrug transport system, permease component
	lhv_1286	yhcI3	ABC-type multidrug transport system, permease component
Position: -56 Score: 5.5 Sequence: AGTGTATTGAGTTAATAATACAGT Locus tag: lhv_1774 Name: ytsC Funciton: Putative antimicrobial peptide ABC exporter, ATP-binding subunit Locus tag: lhv_1773 Name: ytsB Funciton: ABC-type antimicrobial peptide transport system, permease component
	lhv_1774	ytsC	Putative antimicrobial peptide ABC exporter, ATP-binding subunit
	lhv_1773	ytsB	ABC-type antimicrobial peptide transport system, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD