Regulog PdxR3 - Nocardiaceae
| Regulator type: | Transcription factor |
| Regulator family: | GntR/MocR |
| Regulation mode: | |
| Biological process: | Pyridoxine/pyridoxal homeostasis |
| Effector: | |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Nocardiaceae
- By trascription factor - PdxR
- By TF family - GntR/MocR
- By pathway - Pyridoxine/pyridoxal homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Nocardia farcinica IFM 10152 | 2 | 2 |
| Rhodococcus erythropolis PR4 | 2 | 2 |
| Rhodococcus opacus B4 | 4 | 4 |
| Rhodococcus sp. RHA1 | 3 | 3 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| COG2364 |
|
*
Rhodococcus erythropolis PR4 Site: position = -93 score = 3.32446 sequence = ATGCGGGCTTCACGGAAGTGGCAC Site: position = -23 score = 4.66536 sequence = AGTCCAGTATCGACAACTTGGCTA Gene: RER_23600: Predicted membrane protein |
*
Rhodococcus opacus B4 Site: position = -160 score = 3.61312 sequence = GGTCCAGTAACGCCGACATGGCTA Site: position = -238 score = 3.483 sequence = ACGCCGGCTTCACGGAGGTGGCAC Gene: ROP_65020: Predicted membrane protein |
*
Rhodococcus sp. RHA1 Site: position = -6 score = 3.92362 sequence = GGTCCAGTGCCTGCGTGGTGGCTA Site: position = -78 score = 3.65262 sequence = ACGCCGGTTTCACCGAGGTGGCTC Gene: RHA1_ro06449: Predicted membrane protein |
Predicted membrane protein |
| CRON 2. | |||||
| pdxR3 |
*
Nocardia farcinica IFM 10152 Site: position = -26 score = 4.91021 sequence = TAGCCAATCCGCGAATACTGGACT Gene: nfa53660: Transcriptional regulator, GntR/MocR family |
*
Rhodococcus erythropolis PR4 Site: position = -26 score = 4.66536 sequence = TAGCCAAGTTGTCGATACTGGACT Gene: RER_14310: Transcriptional regulator, GntR/MocR family |
*2
Rhodococcus opacus B4 Site: position = -239 score = 3.96268 sequence = GGTCCAGTCCGGATCTTCTGGACT Site: position = -29 score = 4.12566 sequence = TAGCCAAGGGGGTGATACTGGACT Gene: ROP_56250: Transcriptional regulator, GntR/MocR family Site: position = -200 score = 3.15553 sequence = CGGCCAGCCGTTGTATCGCGGGCT Gene: ROP_64330: Transcriptional regulator, GntR/MocR family |
*2
Rhodococcus sp. RHA1 Site: position = -236 score = 3.80113 sequence = AGGCCAGTGCGGATCTTCTGGACT Site: position = -26 score = 3.94143 sequence = TAGCCAAGAGGTTGATACTGGACT Gene: RHA1_ro05556: Transcriptional regulator, GntR/MocR family Site: position = -26 score = 3.48661 sequence = CAGTCCTCTGTGGAAAAGTGGCCT Gene: RHA1_ro06371: Transcriptional regulator, GntR/MocR family |
Transcriptional regulator, GntR/MocR family |
| CRON 3. | |||||
| COG0350 |
*
Nocardia farcinica IFM 10152 Site: position = -67 score = 5.68084 sequence = AGTCCAGTTTCGAAAAACTGGACT Gene: nfa53680: Methylated DNA-protein cysteine methyltransferase |
|
*
Rhodococcus opacus B4 Site: position = -137 score = 3.96268 sequence = AGTCCAGAAGATCCGGACTGGACC Gene: ROP_56230: Methylated DNA-protein cysteine methyltransferase |
Gene: RHA1_ro05553: Methylated DNA-protein cysteine methyltransferase |
Methylated DNA-protein cysteine methyltransferase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |