Regulon of PdxR3 in Nocardia farcinica IFM 10152

Properties
Regulator type:	Transcription factor
TF locus tag:	nfa53660
Regulator family:	GntR/MocR
Regulation mode:
Biological process:	Pyridoxine/pyridoxal homeostasis
Effector:
Regulog:	PdxR3 - Nocardiaceae
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Nocardiaceae
By trascription factor - PdxR
By TF family - GntR/MocR
By pathway - Pyridoxine/pyridoxal homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -67 Score: 5.7 Sequence: AGTCCAGTTTCGAAAAACTGGACT Locus tag: nfa53680 Name: COG0350 Funciton: Methylated DNA-protein cysteine methyltransferase
	nfa53680	COG0350	Methylated DNA-protein cysteine methyltransferase
Position: -26 Score: 4.9 Sequence: TAGCCAATCCGCGAATACTGGACT Locus tag: nfa53660 Name: pdxR3 Funciton: Transcriptional regulator, GntR/MocR family
	nfa53660	pdxR3	Transcriptional regulator, GntR/MocR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD