Regulon of PdxR3 in Rhodococcus opacus B4

Properties
Regulator type:	Transcription factor
TF locus tag:	ROP_56250, ROP_64330
Regulator family:	GntR/MocR
Regulation mode:
Biological process:	Pyridoxine/pyridoxal homeostasis
Effector:
Regulog:	PdxR3 - Nocardiaceae
Statistics of regulated genes:
- Genes	4
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Nocardiaceae
By trascription factor - PdxR
By TF family - GntR/MocR
By pathway - Pyridoxine/pyridoxal homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -137 Score: 4 Sequence: AGTCCAGAAGATCCGGACTGGACC Locus tag: ROP_56230 Name: COG0350 Funciton: Methylated DNA-protein cysteine methyltransferase
	ROP_56230	COG0350	Methylated DNA-protein cysteine methyltransferase
Position: -200 Score: 3.2 Sequence: CGGCCAGCCGTTGTATCGCGGGCT Locus tag: ROP_64330 Name: pdxR3 Funciton: Transcriptional regulator, GntR/MocR family
	ROP_64330	pdxR3	Transcriptional regulator, GntR/MocR family
Position: -238 Score: 3.5 Sequence: ACGCCGGCTTCACGGAGGTGGCAC Position: -160 Score: 3.6 Sequence: GGTCCAGTAACGCCGACATGGCTA Locus tag: ROP_65020 Name: COG2364 Funciton: Predicted membrane protein
	ROP_65020	COG2364	Predicted membrane protein
Position: -239 Score: 4 Sequence: GGTCCAGTCCGGATCTTCTGGACT Position: -29 Score: 4.1 Sequence: TAGCCAAGGGGGTGATACTGGACT Locus tag: ROP_56250 Name: pdxR3 Funciton: Transcriptional regulator, GntR/MocR family
	ROP_56250	pdxR3	Transcriptional regulator, GntR/MocR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD