Regulon of PdxR3 in Rhodococcus sp. RHA1

Properties
Regulator type:	Transcription factor
TF locus tag:	RHA1_ro05556, RHA1_ro06371
Regulator family:	GntR/MocR
Regulation mode:
Biological process:	Pyridoxine/pyridoxal homeostasis
Effector:
Regulog:	PdxR3 - Nocardiaceae
Statistics of regulated genes:
- Genes	3
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Nocardiaceae
By trascription factor - PdxR
By TF family - GntR/MocR
By pathway - Pyridoxine/pyridoxal homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -78 Score: 3.7 Sequence: ACGCCGGTTTCACCGAGGTGGCTC Position: -6 Score: 3.9 Sequence: GGTCCAGTGCCTGCGTGGTGGCTA Locus tag: RHA1_ro06449 Name: COG2364 Funciton: Predicted membrane protein
	RHA1_ro06449	COG2364	Predicted membrane protein
Position: -236 Score: 3.8 Sequence: AGGCCAGTGCGGATCTTCTGGACT Position: -26 Score: 3.9 Sequence: TAGCCAAGAGGTTGATACTGGACT Locus tag: RHA1_ro05556 Name: pdxR3 Funciton: Transcriptional regulator, GntR/MocR family
	RHA1_ro05556	pdxR3	Transcriptional regulator, GntR/MocR family
Position: -26 Score: 3.5 Sequence: CAGTCCTCTGTGGAAAAGTGGCCT Locus tag: RHA1_ro06371 Name: pdxR3 Funciton: Transcriptional regulator, GntR/MocR family
	RHA1_ro06371	pdxR3	Transcriptional regulator, GntR/MocR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD