Regulog ScrR - Alteromonadales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sucrose utilization |
| Effector: | Sucrose |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Alteromonadales
- By TF family - LacI
- By effector - Sucrose
- By pathway - Sucrose utilization
| Genome | Genes | Operons |
|---|---|---|
| Alteromonadales bacterium TW-7 | 4 | 3 |
| Alteromonas macleodii 'Deep ecotype' | 5 | 5 |
| Colwellia psychrerythraea 34H | ||
| Glaciecola sp. HTCC2999 | 10 | 5 |
| Idiomarina baltica OS145 | ||
| Idiomarina loihiensis L2TR | ||
| Pseudoalteromonas atlantica T6c | 5 | 4 |
| Pseudoalteromonas haloplanktis TAC125 | ||
| Pseudoalteromonas tunicata D2 | 4 | 3 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| GHTCC_010100010863 |
|
|
|
*
Glaciecola sp. HTCC2999 Site: position = -75 score = 5.93154 sequence = ACCCTTAATCGATTAAGTTT Gene: GHTCC_010100010863: putative sugar transport protein |
|
|
|
|
|
putative sugar transport protein |
| ogl |
|
|
|
Gene: GHTCC_010100010858: putative oligo-1,6-glucosidase |
|
|
|
|
|
putative oligo-1,6-glucosidase |
| CRON 2. | ||||||||||
| omp(Scr)2 |
|
|
|
*
Glaciecola sp. HTCC2999 Site: position = -109 score = 5.95177 sequence = TTACTTAATCAATTAAGAAA Gene: GHTCC_010100001240: Predicted sucrose-specific TonB-dependent receptor |
|
|
|
|
|
Predicted sucrose-specific TonB-dependent receptor |
| trpH2 |
|
|
|
Gene: GHTCC_010100001235: tryptophan halogenase |
|
|
|
|
|
tryptophan halogenase |
| trpH |
|
|
|
Gene: GHTCC_010100001230: tryptophan halogenase |
|
|
|
|
|
tryptophan halogenase |
| MADE_01454 |
|
|
|
Gene: GHTCC_010100001225: metallo-beta-lactamase family protein |
|
|
|
|
|
metallo-beta-lactamase family protein |
| CRON 3. | ||||||||||
| scrP |
*
Alteromonadales bacterium TW-7 Site: position = -38 score = 6.95982 sequence = TATCTTAATCGATTAAGATT Gene: ATW7_02152: Sucrose phosphorylase (EC 2.4.1.7) |
*
Alteromonas macleodii 'Deep ecotype' Site: position = -202 score = 6.58815 sequence = TATCTTAATCGATTAAGAGT Gene: MADE_01971: Sucrose phosphorylase (EC 2.4.1.7) |
|
*
Glaciecola sp. HTCC2999 Site: position = -37 score = 6.63858 sequence = ATACTTAATCGATTAAGATT Gene: GHTCC_010100011053: Sucrose phosphorylase (EC 2.4.1.7) |
|
|
|
|
*
Pseudoalteromonas tunicata D2 Site: position = -35 score = 6.95982 sequence = TATCTTAATCGATTAAGATT Gene: PTD2_22187: Sucrose phosphorylase (EC 2.4.1.7) |
Sucrose phosphorylase (EC 2.4.1.7) |
| CRON 4. | ||||||||||
| scrR |
Gene: ATW7_02157: Transcriptional regulator for sucrose utilization, LacI family |
*
Alteromonas macleodii 'Deep ecotype' Site: position = -108 score = 5.80045 sequence = TAAGTTAAACGTTTAAGATA Gene: MADE_02629: Transcriptional regulator for sucrose utilization, LacI family |
|
*
Glaciecola sp. HTCC2999 Site: position = -81 score = 5.94409 sequence = TCGCTTAATCGATTAAGTTT Gene: GHTCC_010100004760: Transcriptional regulator for sucrose utilization, LacI family |
|
|
*
Pseudoalteromonas atlantica T6c Site: position = -377 score = 6.29075 sequence = CATCTTAAACGTTTAAGATT Gene: Patl_3821: Transcriptional regulator for sucrose utilization, LacI family |
|
Gene: PTD2_22182: Transcriptional regulator for sucrose utilization, LacI family |
Transcriptional regulator for sucrose utilization, LacI family |
| CRON 5. | ||||||||||
| scrT |
*
Alteromonadales bacterium TW-7 Site: position = -158 score = 6.95982 sequence = AATCTTAATCGATTAAGATA Gene: ATW7_02147: Predicted sucrose permease, MFS family, FucP subfamily |
*
Alteromonas macleodii 'Deep ecotype' Site: position = -211 score = 6.71921 sequence = TATCTTAATCGTTTAAGATT Gene: MADE_00677: Predicted sucrose permease, MFS family, FucP subfamily |
|
|
|
|
*
Pseudoalteromonas atlantica T6c Site: position = -146 score = 6.40017 sequence = TATCTTAAACGATTAAGTTG Gene: Patl_3819: Predicted sucrose permease, MFS family, FucP subfamily |
|
*
Pseudoalteromonas tunicata D2 Site: position = -206 score = 6.95982 sequence = AATCTTAATCGATTAAGATA Gene: PTD2_22192: Predicted sucrose permease, MFS family, FucP subfamily |
Predicted sucrose permease, MFS family, FucP subfamily |
| CRON 6. | ||||||||||
| ATW7_17172 |
Gene: ATW7_17172: Alpha-glucosidase |
|
|
*
Glaciecola sp. HTCC2999 Site: position = -97 score = 6.56292 sequence = AATCTTAATCGTTTAAGTTT Gene: GHTCC_010100000760: Alpha-glucosidase |
|
|
|
Gene: PSHAa2848: Alpha-glucosidase (EC 3.2.1.20) |
Gene: PTD2_01461: Alpha-glucosidase (EC 3.2.1.20) |
Alpha-glucosidase |
| ATW7_16475 |
Gene: ATW7_16475: hypothetical protein |
Gene: MADE_02608: putative ATP synthase F0, A subunit |
Gene: CPS_4187: hypothetical protein |
Gene: GHTCC_010100000755: putative ATP synthase F0, A subunit |
|
|
|
Gene: PSHAa0039: conserved protein of unknown function |
Gene: PTD2_09697: hypothetical protein |
hypothetical protein |
| CRON 7. | ||||||||||
| omp(Scr) |
*
Alteromonadales bacterium TW-7 Site: position = -61 score = 6.35499 sequence = TTACTTAATCGATTAAGTAA Gene: ATW7_02142: Predicted sucrose-specific TonB-dependent receptor |
*
Alteromonas macleodii 'Deep ecotype' Site: position = -101 score = 6.47363 sequence = ATTCTTAATCGATTAAGTAT Gene: MADE_02625: Predicted sucrose-specific TonB-dependent receptor |
|
|
|
|
|
|
*
Pseudoalteromonas tunicata D2 Site: position = -68 score = 6.47583 sequence = TAACTTAATCGATTAAGAAG Gene: PTD2_22197: Predicted sucrose-specific TonB-dependent receptor |
Predicted sucrose-specific TonB-dependent receptor |
| scrK |
Gene: ATW7_02137: Fructokinase (EC 2.7.1.4) |
|
|
|
|
|
|
|
Gene: PTD2_22202: Fructokinase (EC 2.7.1.4) |
Fructokinase (EC 2.7.1.4) |
| CRON 8. | ||||||||||
| ams |
|
*
Alteromonas macleodii 'Deep ecotype' Site: position = -108 score = 6.71921 sequence = AATCTTAAACGATTAAGATA Gene: MADE_00676: Amylosucrase (EC 2.4.1.4) |
|
|
|
|
*
Pseudoalteromonas atlantica T6c Site: position = -160 score = 6.40017 sequence = CAACTTAATCGTTTAAGATA Site: position = -31 score = 5.54075 sequence = TAACTTAATCGTTTTAGACA Gene: Patl_3820: Amylosucrase (EC 2.4.1.4) |
|
|
Amylosucrase (EC 2.4.1.4) |
| CRON 9. | ||||||||||
| Patl_3822 |
|
|
|
|
|
|
*
Pseudoalteromonas atlantica T6c Site: position = -155 score = 6.29075 sequence = AATCTTAAACGTTTAAGATG Gene: Patl_3822: Predicted sucrose transporter |
|
|
Predicted sucrose transporter |
| scrB |
|
|
|
|
|
|
Gene: Patl_3823: Sucrose-6-phosphate hydrolase (EC 3.2.1.26) |
|
|
Sucrose-6-phosphate hydrolase (EC 3.2.1.26) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |