Profile of regulator ScrR in Alteromonadales
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sucrose utilization |
| Effector: | Sucrose |
| Regulog: | ScrR - Alteromonadales |
Member of regulog collections
- By taxonomy - Alteromonadales
- By TF family - LacI
- By effector - Sucrose
- By pathway - Sucrose utilization
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Alteromonadales bacterium TW-7 | |||||
| ATW7_02142 | omp(Scr) | -61 | 6.4 | TTACTTAATCGATTAAGTAA | |
| ATW7_02147 | scrT | -158 | 7 | AATCTTAATCGATTAAGATA | |
| ATW7_02152 | scrP | -38 | 7 | TATCTTAATCGATTAAGATT | |
| Alteromonas macleodii 'Deep ecotype' | |||||
| MADE_02629 | scrR | -108 | 5.8 | TAAGTTAAACGTTTAAGATA | |
| MADE_00677 | scrT | -211 | 6.7 | TATCTTAATCGTTTAAGATT | |
| MADE_00676 | ams | -108 | 6.7 | AATCTTAAACGATTAAGATA | |
| MADE_01971 | scrP | -202 | 6.6 | TATCTTAATCGATTAAGAGT | |
| MADE_02625 | omp(Scr) | -101 | 6.5 | ATTCTTAATCGATTAAGTAT | |
| Glaciecola sp. HTCC2999 | |||||
| GHTCC_010100001240 | omp(Scr)2 | -109 | 6 | TTACTTAATCAATTAAGAAA | |
| GHTCC_010100000760 | null | -97 | 6.6 | AATCTTAATCGTTTAAGTTT | |
| GHTCC_010100010863 | GHTCC_010100010863 | -75 | 5.9 | ACCCTTAATCGATTAAGTTT | |
| GHTCC_010100004760 | scrR | -81 | 5.9 | TCGCTTAATCGATTAAGTTT | |
| GHTCC_010100011053 | scrP | -37 | 6.6 | ATACTTAATCGATTAAGATT | |
| Pseudoalteromonas atlantica T6c | |||||
| Patl_3821 | scrR | -377 | 6.3 | CATCTTAAACGTTTAAGATT | |
| Patl_3819 | scrT | -146 | 6.4 | TATCTTAAACGATTAAGTTG | |
| Patl_3820 | ams | -160 | 6.4 | CAACTTAATCGTTTAAGATA | |
| Patl_3820 | ams | -31 | 5.5 | TAACTTAATCGTTTTAGACA | |
| Patl_3822 | Patl_3822 | -155 | 6.3 | AATCTTAAACGTTTAAGATG | |
| Pseudoalteromonas tunicata D2 | |||||
| PTD2_22197 | omp(Scr) | -68 | 6.5 | TAACTTAATCGATTAAGAAG | |
| PTD2_22192 | scrT | -206 | 7 | AATCTTAATCGATTAAGATA | |
| PTD2_22187 | scrP | -35 | 7 | TATCTTAATCGATTAAGATT | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |