Regulon of ScrR in Pseudoalteromonas atlantica T6c

Properties
Regulator type:	Transcription factor
TF locus tag:	Patl_3821
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sucrose utilization
Effector:	Sucrose
Regulog:	ScrR - Alteromonadales
Statistics of regulated genes:
- Genes	5
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By TF family - LacI
By effector - Sucrose
By pathway - Sucrose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -146 Score: 6.4 Sequence: TATCTTAAACGATTAAGTTG Locus tag: Patl_3819 Name: scrT Funciton: Predicted sucrose permease, MFS family, FucP subfamily
	Patl_3819	scrT	Predicted sucrose permease, MFS family, FucP subfamily
Position: -155 Score: 6.3 Sequence: AATCTTAAACGTTTAAGATG Locus tag: Patl_3822 Name: Patl_3822 Funciton: Predicted sucrose transporter Locus tag: Patl_3823 Name: scrB Funciton: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
	Patl_3822	Patl_3822	Predicted sucrose transporter
	Patl_3823	scrB	Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
Position: -160 Score: 6.4 Sequence: CAACTTAATCGTTTAAGATA Position: -31 Score: 5.5 Sequence: TAACTTAATCGTTTTAGACA Locus tag: Patl_3820 Name: ams Funciton: Amylosucrase (EC 2.4.1.4)
	Patl_3820	ams	Amylosucrase (EC 2.4.1.4)
Position: -377 Score: 6.3 Sequence: CATCTTAAACGTTTAAGATT Locus tag: Patl_3821 Name: scrR Funciton: Transcriptional regulator for sucrose utilization, LacI family
	Patl_3821	scrR	Transcriptional regulator for sucrose utilization, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD