Regulon of ScrR in Alteromonadales bacterium TW-7

Properties
Regulator type:	Transcription factor
TF locus tag:	ATW7_02157
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sucrose utilization
Effector:	Sucrose
Regulog:	ScrR - Alteromonadales
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By TF family - LacI
By effector - Sucrose
By pathway - Sucrose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -61 Score: 6.4 Sequence: TTACTTAATCGATTAAGTAA Locus tag: ATW7_02142 Name: omp(Scr) Funciton: Predicted sucrose-specific TonB-dependent receptor Locus tag: ATW7_02137 Name: scrK Funciton: Fructokinase (EC 2.7.1.4)
	ATW7_02142	omp(Scr)	Predicted sucrose-specific TonB-dependent receptor
	ATW7_02137	scrK	Fructokinase (EC 2.7.1.4)
Position: -158 Score: 7 Sequence: AATCTTAATCGATTAAGATA Locus tag: ATW7_02147 Name: scrT Funciton: Predicted sucrose permease, MFS family, FucP subfamily
	ATW7_02147	scrT	Predicted sucrose permease, MFS family, FucP subfamily
Position: -38 Score: 7 Sequence: TATCTTAATCGATTAAGATT Locus tag: ATW7_02152 Name: scrP Funciton: Sucrose phosphorylase (EC 2.4.1.7)
	ATW7_02152	scrP	Sucrose phosphorylase (EC 2.4.1.7)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD