Regulon of ScrR in Pseudoalteromonas tunicata D2

Properties
Regulator type:	Transcription factor
TF locus tag:	PTD2_22182
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sucrose utilization
Effector:	Sucrose
Regulog:	ScrR - Alteromonadales
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By TF family - LacI
By effector - Sucrose
By pathway - Sucrose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -68 Score: 6.5 Sequence: TAACTTAATCGATTAAGAAG Locus tag: PTD2_22197 Name: omp(Scr) Funciton: Predicted sucrose-specific TonB-dependent receptor Locus tag: PTD2_22202 Name: scrK Funciton: Fructokinase (EC 2.7.1.4)
	PTD2_22197	omp(Scr)	Predicted sucrose-specific TonB-dependent receptor
	PTD2_22202	scrK	Fructokinase (EC 2.7.1.4)
Position: -35 Score: 7 Sequence: TATCTTAATCGATTAAGATT Locus tag: PTD2_22187 Name: scrP Funciton: Sucrose phosphorylase (EC 2.4.1.7)
	PTD2_22187	scrP	Sucrose phosphorylase (EC 2.4.1.7)
Position: -206 Score: 7 Sequence: AATCTTAATCGATTAAGATA Locus tag: PTD2_22192 Name: scrT Funciton: Predicted sucrose permease, MFS family, FucP subfamily
	PTD2_22192	scrT	Predicted sucrose permease, MFS family, FucP subfamily

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD