Regulon of ScrR in Glaciecola sp. HTCC2999

Properties
Regulator type:	Transcription factor
TF locus tag:	GHTCC_010100004760
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sucrose utilization
Effector:	Sucrose
Regulog:	ScrR - Alteromonadales
Statistics of regulated genes:
- Genes	10
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By TF family - LacI
By effector - Sucrose
By pathway - Sucrose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -97 Score: 6.6 Sequence: AATCTTAATCGTTTAAGTTT Locus tag: GHTCC_010100000760 Name: null Funciton: Alpha-glucosidase Locus tag: GHTCC_010100000755 Name: null Funciton: putative ATP synthase F0, A subunit
	GHTCC_010100000760		Alpha-glucosidase
	GHTCC_010100000755		putative ATP synthase F0, A subunit
Position: -75 Score: 5.9 Sequence: ACCCTTAATCGATTAAGTTT Locus tag: GHTCC_010100010863 Name: GHTCC_010100010863 Funciton: putative sugar transport protein Locus tag: GHTCC_010100010858 Name: ogl Funciton: putative oligo-1,6-glucosidase
	GHTCC_010100010863	GHTCC_010100010863	putative sugar transport protein
	GHTCC_010100010858	ogl	putative oligo-1,6-glucosidase
Position: -109 Score: 6 Sequence: TTACTTAATCAATTAAGAAA Locus tag: GHTCC_010100001240 Name: omp(Scr)2 Funciton: Predicted sucrose-specific TonB-dependent receptor Locus tag: GHTCC_010100001235 Name: trpH2 Funciton: tryptophan halogenase Locus tag: GHTCC_010100001230 Name: trpH Funciton: tryptophan halogenase Locus tag: GHTCC_010100001225 Name: null Funciton: metallo-beta-lactamase family protein
	GHTCC_010100001240	omp(Scr)2	Predicted sucrose-specific TonB-dependent receptor
	GHTCC_010100001235	trpH2	tryptophan halogenase
	GHTCC_010100001230	trpH	tryptophan halogenase
	GHTCC_010100001225		metallo-beta-lactamase family protein
Position: -37 Score: 6.6 Sequence: ATACTTAATCGATTAAGATT Locus tag: GHTCC_010100011053 Name: scrP Funciton: Sucrose phosphorylase (EC 2.4.1.7)
	GHTCC_010100011053	scrP	Sucrose phosphorylase (EC 2.4.1.7)
Position: -81 Score: 5.9 Sequence: TCGCTTAATCGATTAAGTTT Locus tag: GHTCC_010100004760 Name: scrR Funciton: Transcriptional regulator for sucrose utilization, LacI family
	GHTCC_010100004760	scrR	Transcriptional regulator for sucrose utilization, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD