Regulog MalR2 - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Maltose utilization; Maltodextrin utilization |
| Effector: | Maltose |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - LacI
- By effector - Maltose
- By pathway - Maltose utilization
- By pathway - Maltodextrin utilization
| Genome | Genes | Operons |
|---|---|---|
| Anoxybacillus flavithermus WK1 | 8 | 3 |
| Bacillus amyloliquefaciens FZB42 | ||
| Bacillus cereus ATCC 14579 | 2 | 2 |
| Bacillus clausii KSM-K16 | 6 | 3 |
| Bacillus halodurans C-125 | 7 | 4 |
| Bacillus licheniformis DSM 13 | ||
| Bacillus pumilus SAFR-032 | ||
| Bacillus subtilis subsp. subtilis str. 168 | ||
| Geobacillus kaustophilus HTA426 | 7 | 3 |
| Oceanobacillus iheyensis HTE831 | 2 | 2 |
| Paenibacillus sp. JDR-2 | 1 | 1 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| nplT |
*
Anoxybacillus flavithermus WK1 Site: position = -228 score = 6.44067 sequence = TTGCGAAAACGATTGCACAA Gene: Aflv_2192: Neopullulanase (EC 3.2.1.135) |
|
*
Bacillus cereus ATCC 14579 Site: position = -233 score = 5.79595 sequence = CTATGAAAACGTTTGCGCTA Gene: BC4014: Neopullulanase (EC 3.2.1.135) |
*
Bacillus clausii KSM-K16 Site: position = -221 score = 6.09429 sequence = TGGTGAAATCGTTTGCACAA Gene: ABC4031: Neopullulanase (EC 3.2.1.135) |
*
Bacillus halodurans C-125 Site: position = -254 score = 6.05925 sequence = TTAGGAAATCGTTTGCACAA Gene: BH2927: Neopullulanase (EC 3.2.1.135) |
Gene: BLi00658: Neopullulanase (EC 3.2.1.135) |
|
Gene: BSU34620: Neopullulanase (EC 3.2.1.135) |
*
Geobacillus kaustophilus HTA426 Site: position = -201 score = 5.51026 sequence = TAAGGAAAACGTTTGCGCAA Site: position = -164 score = 5.79978 sequence = CTATGAAAACGATTGCACCA Gene: GK0703: Neopullulanase (EC 3.2.1.135) |
*
Oceanobacillus iheyensis HTE831 Site: position = -230 score = 4.9846 sequence = TTGCGCAACCGGTTGCACAT Site: position = -176 score = 6.0339 sequence = TTACGCAAGCGCTTTCACAA Gene: OB2561: Neopullulanase (EC 3.2.1.135) |
Gene: Pjdr2_1045: Neopullulanase (EC 3.2.1.135) |
Neopullulanase (EC 3.2.1.135) |
| CRON 2. | ||||||||||||
| malE |
*
Anoxybacillus flavithermus WK1 Site: position = 91 score = 6.19868 sequence = TTGTGCAATCGTTTTCGCAA Gene: Aflv_2191: Maltose/maltodextrin ABC transporter, substrate-binding protein |
|
|
*
Bacillus clausii KSM-K16 Site: position = -89 score = 6.17098 sequence = TTGTGCAAACGATTTCACCA Gene: ABC4030: Maltose/maltodextrin ABC transporter, substrate-binding protein |
*
Bacillus halodurans C-125 Site: position = -87 score = 6.18357 sequence = TTGTGCAAACGATTTCCTAA Gene: BH2926: Maltose/maltodextrin ABC transporter, substrate-binding protein |
|
|
|
*
Geobacillus kaustophilus HTA426 Site: position = -101 score = 5.33133 sequence = TGGTGCAATCGTTTTCATAG Site: position = -64 score = 5.96442 sequence = TTGCGCAAACGTTTTCCTTA Gene: GK0704: Maltose/maltodextrin ABC transporter, substrate-binding protein |
*
Oceanobacillus iheyensis HTE831 Site: position = -126 score = 6.04572 sequence = TTGTGAAAGCGCTTGCGTAA Gene: OB2560: Maltose/maltodextrin ABC transporter, substrate-binding protein |
Gene: Pjdr2_0961: Maltose/maltodextrin ABC transporter, substrate-binding protein |
Maltose/maltodextrin ABC transporter, substrate-binding protein |
| malF |
Gene: Aflv_2190: Maltose/maltodextrin ABC transporter, permease protein 1 |
|
|
Gene: ABC4029: Maltose/maltodextrin ABC transporter, permease protein 1 |
Gene: BH2925: Maltose/maltodextrin ABC transporter, permease protein 1 |
|
|
|
Gene: GK0705: Maltose/maltodextrin ABC transporter, permease protein 1 |
Gene: OB2559: Maltose/maltodextrin ABC transporter, permease protein 1 |
Gene: Pjdr2_0962: Maltose/maltodextrin ABC transporter, permease protein 1 |
Maltose/maltodextrin ABC transporter, permease protein 1 |
| malG |
Gene: Aflv_2189: Maltose/maltodextrin ABC transporter, permease protein 2 |
|
|
Gene: ABC4028: Maltose/maltodextrin ABC transporter, permease protein 2 |
Gene: BH2924: Maltose/maltodextrin ABC transporter, permease protein 2 |
|
|
|
Gene: GK0706: Maltose/maltodextrin ABC transporter, permease protein 2 |
Gene: OB2558: Maltose/maltodextrin ABC transporter, permease protein 2 |
Gene: Pjdr2_0963: Maltose/maltodextrin ABC transporter, permease protein 2 |
Maltose/maltodextrin ABC transporter, permease protein 2 |
| nplT2 |
Gene: Aflv_2188: Neopullulanase (EC 3.2.1.135) |
|
|
|
|
|
|
|
Gene: GK0707: Neopullulanase (EC 3.2.1.135) |
|
|
Neopullulanase (EC 3.2.1.135) |
| Aflv_2187 |
Gene: Aflv_2187: Alpha-glucosidase (EC 3.2.1.20) |
|
|
|
|
|
|
|
|
|
|
Alpha-glucosidase (EC 3.2.1.20) |
| malR2 |
Gene: Aflv_2186: Maltose utilization transcriptional regulator MalR2, LacI family |
|
Gene: BC4010: Maltose utilization transcriptional regulator MalR2, LacI family |
Gene: ABC4027: Maltose utilization transcriptional regulator MalR2, LacI family |
Gene: BH2923: Maltose utilization transcriptional regulator MalR2, LacI family |
|
|
|
Gene: GK0708: Maltose utilization transcriptional regulator MalR2, LacI family |
Gene: OB2557: Maltose utilization transcriptional regulator MalR2, LacI family |
|
Maltose utilization transcriptional regulator MalR2, LacI family |
| CRON 3. | ||||||||||||
| BH0413 |
|
|
|
*
Bacillus clausii KSM-K16 Site: position = -44 score = 5.95194 sequence = TTGTGCAAACGTTTGCTTAA Gene: ABC1611: Predicted alpha-amylase precusrsor |
*
Bacillus halodurans C-125 Site: position = -41 score = 6.26917 sequence = TTGTGCAAACGTTTGCCTAA Gene: BH0413: Predicted alpha-amylase precusrsor |
|
|
|
|
|
|
Predicted alpha-amylase precusrsor |
| CRON 4. | ||||||||||||
| malL |
|
|
*
Bacillus cereus ATCC 14579 Site: position = -63 score = 4.90879 sequence = TAATGAAAACGTTTGCGCCT Site: position = -241 score = 5.04573 sequence = TTATGCAAACGTTTTCTTTG Gene: BC4015: Oligo-1,6-glucosidase (EC 3.2.1.10) |
|
*
Bacillus halodurans C-125 Site: position = -32 score = 5.41834 sequence = TTACGTAAACGTTTTCGTTA Gene: BH2903: Oligo-1,6-glucosidase (EC 3.2.1.10) |
|
|
|
|
|
|
Oligo-1,6-glucosidase (EC 3.2.1.10) |
| CRON 5. | ||||||||||||
| amyA |
*
Anoxybacillus flavithermus WK1 Site: position = -52 score = 5.16826 sequence = TTGTGCAAACGGTTTCGCTT Gene: Aflv_2609: Maltodextrin glucosidase (EC 3.2.1.20) |
|
|
|
|
|
|
|
*
Geobacillus kaustophilus HTA426 Site: position = -50 score = 6.48832 sequence = TTGTGCAAACGATTGCACAA Site: position = -286 score = 5.02826 sequence = TAAGGGAAACGATTGCATAA Site: position = -76 score = 5.58063 sequence = TGATGAAATCGTTTGCATCA Gene: GK3180: Maltodextrin glucosidase (EC 3.2.1.20) |
|
*
Paenibacillus sp. JDR-2 Site: position = -50 score = 6.23663 sequence = TTGTGCAATCGTTTGCCCAA Gene: Pjdr2_5200: Maltodextrin glucosidase (EC 3.2.1.20) |
Maltodextrin glucosidase (EC 3.2.1.20) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |