Regulon of MalR2 in Bacillus clausii KSM-K16

Properties
Regulator type:	Transcription factor
TF locus tag:	ABC4027
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Regulog:	MalR2 - Bacillales
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization
By pathway - Maltodextrin utilization

Regulated operons
	Locus Tag	Name	Function
Position: -89 Score: 6.2 Sequence: TTGTGCAAACGATTTCACCA Locus tag: ABC4030 Name: malE Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein Locus tag: ABC4029 Name: malF Funciton: Maltose/maltodextrin ABC transporter, permease protein 1 Locus tag: ABC4028 Name: malG Funciton: Maltose/maltodextrin ABC transporter, permease protein 2 Locus tag: ABC4027 Name: malR2 Funciton: Maltose utilization transcriptional regulator MalR2, LacI family
	ABC4030	malE	Maltose/maltodextrin ABC transporter, substrate-binding protein
	ABC4029	malF	Maltose/maltodextrin ABC transporter, permease protein 1
	ABC4028	malG	Maltose/maltodextrin ABC transporter, permease protein 2
	ABC4027	malR2	Maltose utilization transcriptional regulator MalR2, LacI family
Position: -221 Score: 6.1 Sequence: TGGTGAAATCGTTTGCACAA Locus tag: ABC4031 Name: nplT Funciton: Neopullulanase (EC 3.2.1.135)
	ABC4031	nplT	Neopullulanase (EC 3.2.1.135)
Position: -44 Score: 6 Sequence: TTGTGCAAACGTTTGCTTAA Locus tag: ABC1611 Name: BH0413 Funciton: Predicted alpha-amylase precusrsor
	ABC1611	BH0413	Predicted alpha-amylase precusrsor

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD