Regulon of MalR2 in Oceanobacillus iheyensis HTE831

Properties
Regulator type:	Transcription factor
TF locus tag:	OB2557
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Regulog:	MalR2 - Bacillales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization
By pathway - Maltodextrin utilization

Regulated operons
	Locus Tag	Name	Function
Position: -230 Score: 5 Sequence: TTGCGCAACCGGTTGCACAT Position: -176 Score: 6 Sequence: TTACGCAAGCGCTTTCACAA Locus tag: OB2561 Name: nplT Funciton: Neopullulanase (EC 3.2.1.135)
	OB2561	nplT	Neopullulanase (EC 3.2.1.135)
Position: -126 Score: 6 Sequence: TTGTGAAAGCGCTTGCGTAA Locus tag: OB2560 Name: malE Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein
	OB2560	malE	Maltose/maltodextrin ABC transporter, substrate-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD