Regulon of MalR2 in Geobacillus kaustophilus HTA426

Properties
Regulator type:	Transcription factor
TF locus tag:	GK0708
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Regulog:	MalR2 - Bacillales
Statistics of regulated genes:
- Genes	7
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization
By pathway - Maltodextrin utilization

Regulated operons
	Locus Tag	Name	Function
Position: -286 Score: 5 Sequence: TAAGGGAAACGATTGCATAA Position: -76 Score: 5.6 Sequence: TGATGAAATCGTTTGCATCA Position: -50 Score: 6.5 Sequence: TTGTGCAAACGATTGCACAA Locus tag: GK3180 Name: amyA Funciton: Maltodextrin glucosidase (EC 3.2.1.20)
	GK3180	amyA	Maltodextrin glucosidase (EC 3.2.1.20)
Position: -101 Score: 5.3 Sequence: TGGTGCAATCGTTTTCATAG Position: -64 Score: 6 Sequence: TTGCGCAAACGTTTTCCTTA Locus tag: GK0704 Name: malE Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein Locus tag: GK0705 Name: malF Funciton: Maltose/maltodextrin ABC transporter, permease protein 1 Locus tag: GK0706 Name: malG Funciton: Maltose/maltodextrin ABC transporter, permease protein 2 Locus tag: GK0707 Name: nplT2 Funciton: Neopullulanase (EC 3.2.1.135) Locus tag: GK0708 Name: malR2 Funciton: Maltose utilization transcriptional regulator MalR2, LacI family
	GK0704	malE	Maltose/maltodextrin ABC transporter, substrate-binding protein
	GK0705	malF	Maltose/maltodextrin ABC transporter, permease protein 1
	GK0706	malG	Maltose/maltodextrin ABC transporter, permease protein 2
	GK0707	nplT2	Neopullulanase (EC 3.2.1.135)
	GK0708	malR2	Maltose utilization transcriptional regulator MalR2, LacI family
Position: -201 Score: 5.5 Sequence: TAAGGAAAACGTTTGCGCAA Position: -164 Score: 5.8 Sequence: CTATGAAAACGATTGCACCA Locus tag: GK0703 Name: nplT Funciton: Neopullulanase (EC 3.2.1.135)
	GK0703	nplT	Neopullulanase (EC 3.2.1.135)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD