Regulon of MalR2 in Anoxybacillus flavithermus WK1

Properties
Regulator type:	Transcription factor
TF locus tag:	Aflv_2186
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Regulog:	MalR2 - Bacillales
Statistics of regulated genes:
- Genes	8
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization
By pathway - Maltodextrin utilization

Regulated operons
	Locus Tag	Name	Function
Position: -52 Score: 5.2 Sequence: TTGTGCAAACGGTTTCGCTT Locus tag: Aflv_2609 Name: amyA Funciton: Maltodextrin glucosidase (EC 3.2.1.20)
	Aflv_2609	amyA	Maltodextrin glucosidase (EC 3.2.1.20)
Position: 91 Score: 6.2 Sequence: TTGTGCAATCGTTTTCGCAA Locus tag: Aflv_2191 Name: malE Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein Locus tag: Aflv_2190 Name: malF Funciton: Maltose/maltodextrin ABC transporter, permease protein 1 Locus tag: Aflv_2189 Name: malG Funciton: Maltose/maltodextrin ABC transporter, permease protein 2 Locus tag: Aflv_2188 Name: nplT2 Funciton: Neopullulanase (EC 3.2.1.135) Locus tag: Aflv_2187 Name: null Funciton: Alpha-glucosidase (EC 3.2.1.20) Locus tag: Aflv_2186 Name: malR2 Funciton: Maltose utilization transcriptional regulator MalR2, LacI family
	Aflv_2191	malE	Maltose/maltodextrin ABC transporter, substrate-binding protein
	Aflv_2190	malF	Maltose/maltodextrin ABC transporter, permease protein 1
	Aflv_2189	malG	Maltose/maltodextrin ABC transporter, permease protein 2
	Aflv_2188	nplT2	Neopullulanase (EC 3.2.1.135)
	Aflv_2187		Alpha-glucosidase (EC 3.2.1.20)
	Aflv_2186	malR2	Maltose utilization transcriptional regulator MalR2, LacI family
Position: -228 Score: 6.4 Sequence: TTGCGAAAACGATTGCACAA Locus tag: Aflv_2192 Name: nplT Funciton: Neopullulanase (EC 3.2.1.135)
	Aflv_2192	nplT	Neopullulanase (EC 3.2.1.135)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD