Regulog CC1627 - Caulobacterales

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Phylum:	Proteobacteria/Alpha
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Caulobacterales
By TF family - LacI
By pathway - Sugar utilization

Statistics of regulated genes
Genome	Genes	Operons
Caulobacter crescentus CB15	9	4
Caulobacter segnis ATCC 21756	8	3
Caulobacter sp. K31	11	5
Phenylobacterium zucineum HLK1	8	2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes					Function

CRON 1.
CC1628	* Caulobacter crescentus CB15 Site: position = -81 score = 4.72593 sequence = CGATGAATTCGATTACATTG Gene: CC1628: nucleoside:H symporter	* Caulobacter segnis ATCC 21756 Site: position = -81 score = 4.40495 sequence = CGATGATTTCGATTACATCG Gene: Cseg_2113: nucleoside:H symporter	* Caulobacter sp. K31 Site: position = -83 score = 4.3289 sequence = CGATGATTTCGATTACATCA Gene: Caul_4612: nucleoside:H symporter	* Phenylobacterium zucineum HLK1 Site: position = -67 score = 5.36433 sequence = ACGTGTAATCGATTACATCG Gene: PHZ_c2157: nucleoside:H symporter	nucleoside:H symporter
CC1629	Caulobacter crescentus CB15 Gene: CC1629: Sugar phosphate isomerases/epimerases	Caulobacter segnis ATCC 21756 Gene: Cseg_2112: Sugar phosphate isomerases/epimerases	Caulobacter sp. K31 Gene: Caul_4611: Sugar phosphate isomerases/epimerases	Phenylobacterium zucineum HLK1 Gene: PHZ_c2156: Sugar phosphate isomerases/epimerases	Sugar phosphate isomerases/epimerases
CC1630	Caulobacter crescentus CB15 Gene: CC1630: Oxidoreductase (EC 1.1.1.-)	Caulobacter segnis ATCC 21756 Gene: Cseg_2111: Oxidoreductase (EC 1.1.1.-)	2 Caulobacter sp. K31* Gene: Caul_4610: Oxidoreductase (EC 1.1.1.-) Site: position = -51 score = 4.82579 sequence = ATATGTAATCGAATACACAA Gene: Caul_0426: Oxidoreductase (EC 1.1.1.-)	Phenylobacterium zucineum HLK1 Gene: PHZ_c2155: Oxidoreductase (EC 1.1.1.-)	Oxidoreductase (EC 1.1.1.-)
CC1631	Caulobacter crescentus CB15 Gene: CC1631: Sugar phosphate isomerases/epimerases	Caulobacter segnis ATCC 21756 Gene: Cseg_2110: Sugar phosphate isomerases/epimerases	2 Caulobacter sp. K31 Gene: Caul_4609: Sugar phosphate isomerases/epimerases Gene: Caul_0427: Sugar phosphate isomerases/epimerases	Phenylobacterium zucineum HLK1 Gene: PHZ_c2154: Sugar phosphate isomerases/epimerases	Sugar phosphate isomerases/epimerases
CC1634	* Caulobacter crescentus CB15 Site: position = -117 score = 4.71282 sequence = CAATGTAACCCATTTCATGG Gene: CC1634: Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site	* Caulobacter segnis ATCC 21756 Site: position = -119 score = 4.71282 sequence = CAATGTAACCCATTTCATGG Gene: Cseg_2107: Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site	* Caulobacter sp. K31 Site: position = -118 score = 4.71282 sequence = CAATGTAACCCATTTCATGG Gene: Caul_4606: Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site	Phenylobacterium zucineum HLK1 Gene: PHZ_c2153: Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site	Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site
CC1635	Caulobacter crescentus CB15 Gene: CC1635: hypothetical protein	Caulobacter segnis ATCC 21756 Gene: Cseg_2106: hypothetical protein	Caulobacter sp. K31 Gene: Caul_4605: hypothetical protein	Phenylobacterium zucineum HLK1 Gene: PHZ_c2152: hypothetical protein	hypothetical protein
PHZ_c2151	Caulobacter crescentus CB15	Caulobacter segnis ATCC 21756	Caulobacter sp. K31	Phenylobacterium zucineum HLK1 Gene: PHZ_c2151: hypothetical protein	hypothetical protein
cyc	Caulobacter crescentus CB15 Gene: CC1632: Cytochrome c2	Caulobacter segnis ATCC 21756 Gene: Cseg_2109: Cytochrome c2	Caulobacter sp. K31 Gene: Caul_4608: Cytochrome c2	Phenylobacterium zucineum HLK1 Gene: PHZ_c0286: Cytochrome c2	Cytochrome c2

CRON 2.
CC1627	* Caulobacter crescentus CB15 Site: position = -116 score = 4.72593 sequence = CAATGTAATCGAATTCATCG Gene: CC1627: Transcriptional regulator, LacI family	* Caulobacter segnis ATCC 21756 Site: position = -118 score = 4.40495 sequence = CGATGTAATCGAAATCATCG Gene: Cseg_2114: Transcriptional regulator, LacI family	* Caulobacter sp. K31 Site: position = -119 score = 4.3289 sequence = TGATGTAATCGAAATCATCG Gene: Caul_4613: Transcriptional regulator, LacI family	* Phenylobacterium zucineum HLK1 Site: position = -40 score = 5.36433 sequence = CGATGTAATCGATTACACGT Gene: PHZ_c2158: Transcriptional regulator, LacI family	Transcriptional regulator, LacI family

CRON 3.
PF06439	* Caulobacter crescentus CB15 Site: position = -54 score = 4.71282 sequence = CCATGAAATGGGTTACATTG Gene: CC1633: Domain of Unknown Function (DUF1080)	Caulobacter segnis ATCC 21756 Gene: Cseg_2108: Domain of Unknown Function (DUF1080)	* Caulobacter sp. K31 Site: position = -78 score = 4.71282 sequence = CCATGAAATGGGTTACATTG Gene: Caul_4607: Domain of Unknown Function (DUF1080)	Phenylobacterium zucineum HLK1	Domain of Unknown Function (DUF1080)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog CC1627 - Caulobacterales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --