Regulon of CC1627 in Phenylobacterium zucineum HLK1

Properties
Regulator type:	Transcription factor
TF locus tag:	PHZ_c2158
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	CC1627 - Caulobacterales
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Caulobacterales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -40 Score: 5.4 Sequence: CGATGTAATCGATTACACGT Locus tag: PHZ_c2158 Name: null Funciton: Transcriptional regulator, LacI family
	PHZ_c2158		Transcriptional regulator, LacI family
Position: -67 Score: 5.4 Sequence: ACGTGTAATCGATTACATCG Locus tag: PHZ_c2157 Name: null Funciton: nucleoside:H symporter Locus tag: PHZ_c2156 Name: null Funciton: Sugar phosphate isomerases/epimerases Locus tag: PHZ_c2155 Name: null Funciton: Oxidoreductase (EC 1.1.1.-) Locus tag: PHZ_c2154 Name: null Funciton: Sugar phosphate isomerases/epimerases Locus tag: PHZ_c2153 Name: null Funciton: Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site Locus tag: PHZ_c2152 Name: null Funciton: hypothetical protein Locus tag: PHZ_c2151 Name: null Funciton: hypothetical protein
	PHZ_c2157		nucleoside:H symporter
	PHZ_c2156		Sugar phosphate isomerases/epimerases
	PHZ_c2155		Oxidoreductase (EC 1.1.1.-)
	PHZ_c2154		Sugar phosphate isomerases/epimerases
	PHZ_c2153		Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site
	PHZ_c2152		hypothetical protein
	PHZ_c2151		hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD