Regulon of CC1627 in Caulobacter segnis ATCC 21756

Properties
Regulator type:	Transcription factor
TF locus tag:	Cseg_2114
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	CC1627 - Caulobacterales
Statistics of regulated genes:
- Genes	8
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Caulobacterales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -119 Score: 4.7 Sequence: CAATGTAACCCATTTCATGG Locus tag: Cseg_2107 Name: null Funciton: Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site Locus tag: Cseg_2106 Name: null Funciton: hypothetical protein
	Cseg_2107		Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site
	Cseg_2106		hypothetical protein
Position: -81 Score: 4.4 Sequence: CGATGATTTCGATTACATCG Locus tag: Cseg_2113 Name: null Funciton: nucleoside:H symporter Locus tag: Cseg_2112 Name: null Funciton: Sugar phosphate isomerases/epimerases Locus tag: Cseg_2111 Name: null Funciton: Oxidoreductase (EC 1.1.1.-) Locus tag: Cseg_2110 Name: null Funciton: Sugar phosphate isomerases/epimerases Locus tag: Cseg_2109 Name: cyc Funciton: Cytochrome c2
	Cseg_2113		nucleoside:H symporter
	Cseg_2112		Sugar phosphate isomerases/epimerases
	Cseg_2111		Oxidoreductase (EC 1.1.1.-)
	Cseg_2110		Sugar phosphate isomerases/epimerases
	Cseg_2109	cyc	Cytochrome c2
Position: -118 Score: 4.4 Sequence: CGATGTAATCGAAATCATCG Locus tag: Cseg_2114 Name: null Funciton: Transcriptional regulator, LacI family
	Cseg_2114		Transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD