Regulon of CC1627 in Caulobacter crescentus CB15

Properties
Regulator type:	Transcription factor
TF locus tag:	CC1627
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	CC1627 - Caulobacterales
Statistics of regulated genes:
- Genes	9
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Caulobacterales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -116 Score: 4.7 Sequence: CAATGTAATCGAATTCATCG Locus tag: CC1627 Name: null Funciton: Transcriptional regulator, LacI family
	CC1627		Transcriptional regulator, LacI family
Position: -117 Score: 4.7 Sequence: CAATGTAACCCATTTCATGG Locus tag: CC1634 Name: null Funciton: Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site Locus tag: CC1635 Name: null Funciton: hypothetical protein
	CC1634		Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site
	CC1635		hypothetical protein
Position: -81 Score: 4.7 Sequence: CGATGAATTCGATTACATTG Locus tag: CC1628 Name: null Funciton: nucleoside:H symporter Locus tag: CC1629 Name: null Funciton: Sugar phosphate isomerases/epimerases Locus tag: CC1630 Name: null Funciton: Oxidoreductase (EC 1.1.1.-) Locus tag: CC1631 Name: null Funciton: Sugar phosphate isomerases/epimerases Locus tag: CC1632 Name: cyc Funciton: Cytochrome c2
	CC1628		nucleoside:H symporter
	CC1629		Sugar phosphate isomerases/epimerases
	CC1630		Oxidoreductase (EC 1.1.1.-)
	CC1631		Sugar phosphate isomerases/epimerases
	CC1632	cyc	Cytochrome c2
Position: -54 Score: 4.7 Sequence: CCATGAAATGGGTTACATTG Locus tag: CC1633 Name: PF06439 Funciton: Domain of Unknown Function (DUF1080)
	CC1633	PF06439	Domain of Unknown Function (DUF1080)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD