Orthologous regulated operons containing CC1634 gene

Properties
Regulog:	CC1627 - Caulobacterales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Phylum:	Proteobacteria/Alpha

Built upon 14 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Caulobacter crescentus CB15
Position: -117 Score: 4.71282 Sequence: CAATGTAACCCATTTCATGG Locus tag: CC1634 Name: null Funciton: Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site Locus tag: CC1635 Name: null Funciton: hypothetical protein
CC1634-CC1635	-117	4.7	CAATGTAACCCATTTCATGG	CC1634
Caulobacter segnis ATCC 21756
Position: -119 Score: 4.71282 Sequence: CAATGTAACCCATTTCATGG Locus tag: Cseg_2107 Name: null Funciton: Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site Locus tag: Cseg_2106 Name: null Funciton: hypothetical protein
Cseg_2107-Cseg_2106	-119	4.7	CAATGTAACCCATTTCATGG	Cseg_2107
Caulobacter sp. K31
Position: -118 Score: 4.71282 Sequence: CAATGTAACCCATTTCATGG Locus tag: Caul_4606 Name: null Funciton: Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site Locus tag: Caul_4605 Name: null Funciton: hypothetical protein
Caul_4606-Caul_4605	-118	4.7	CAATGTAACCCATTTCATGG	Caul_4606
Phenylobacterium zucineum HLK1
Position: -67 Score: 5.36433 Sequence: ACGTGTAATCGATTACATCG Locus tag: PHZ_c2157 Name: null Funciton: nucleoside:H symporter Locus tag: PHZ_c2156 Name: null Funciton: Sugar phosphate isomerases/epimerases Locus tag: PHZ_c2155 Name: null Funciton: Oxidoreductase (EC 1.1.1.-) Locus tag: PHZ_c2154 Name: null Funciton: Sugar phosphate isomerases/epimerases Locus tag: PHZ_c2153 Name: null Funciton: Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site Locus tag: PHZ_c2152 Name: null Funciton: hypothetical protein Locus tag: PHZ_c2151 Name: null Funciton: hypothetical protein
PHZ_c2157-PHZ_c2156-PHZ_c2155-PHZ_c2154-PHZ_c2153-PHZ_c2152-PHZ_c2151	-67	5.4	ACGTGTAATCGATTACATCG	PHZ_c2157