Regulog SMc04260 - Rhizobiales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhizobiales
- By TF family - LacI
- By pathway - Sugar utilization
| Genome | Genes | Operons |
|---|---|---|
| Agrobacterium tumefaciens str. C58 (Cereon) | 8 | 4 |
| Azorhizobium caulinodans ORS 571 | ||
| Bartonella quintana str. Toulouse | ||
| Bradyrhizobium japonicum USDA 110 | ||
| Bradyrhizobium sp. BTAi1 | ||
| Brucella melitensis 16M | ||
| Mesorhizobium loti MAFF303099 | 7 | 2 |
| Mesorhizobium sp. BNC1 | ||
| Nitrobacter winogradskyi Nb-255 | ||
| Rhizobium etli CFN 42 | 5 | 2 |
| Rhizobium leguminosarum bv. viciae 3841 | 9 | 3 |
| Rhizobium sp. NGR234 | 2 | 2 |
| Rhodopseudomonas palustris CGA009 | ||
| Sinorhizobium meliloti 1021 | 8 | 2 |
| Xanthobacter autotrophicus Py2 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| bgl |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -105 score = 5.09187 sequence = ATCCTGAAACGTTGTAGATT Gene: Atu4485: Beta-glucosidase |
|
|
|
|
|
|
|
|
*
Rhizobium etli CFN 42 Site: position = -108 score = 5.90148 sequence = CTACTGTAACGTTGCAGTTT Gene: RHE_CH03640: Beta-glucosidase |
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -102 score = 5.69392 sequence = CTCCTGCAACGTTGCAGTTT Gene: RL4168: Beta-glucosidase |
Gene: NGR_c29440: Beta-glucosidase |
|
Gene: SMc03160: Beta-glucosidase |
|
Beta-glucosidase |
| CRON 2. | ||||||||||||||||
| SMc04260 |
Gene: Atu1522: Transcriptional regulator, LacI family |
|
|
|
|
|
*
Mesorhizobium loti MAFF303099 Site: position = -116 score = 5.74518 sequence = AATCTGTAACGTTTCAGTAT Gene: mlr3320: Transcriptional regulator, LacI family |
|
|
Gene: RHE_CH02462: Transcriptional regulator, LacI family |
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -119 score = 5.60457 sequence = CTACTGTATCGTTACAGATT Gene: RL2797: Transcriptional regulator, LacI family |
*
Rhizobium sp. NGR234 Site: position = -175 score = 5.62812 sequence = CTACTGTATCGTTACAGATA Gene: NGR_c17850: Transcriptional regulator, LacI family |
|
*
Sinorhizobium meliloti 1021 Site: position = -143 score = 5.60457 sequence = CTACTGTATCGTTACAGATT Gene: SMc04260: Transcriptional regulator, LacI family |
|
Transcriptional regulator, LacI family |
| CRON 3. | ||||||||||||||||
| SMc04259 |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -32 score = 5.67861 sequence = CTACTGCAACGTTTCAGTGA Gene: Atu3352: Sugar ABC transporter, substrate-binding protein |
|
|
|
|
|
*
Mesorhizobium loti MAFF303099 Site: position = -35 score = 5.56701 sequence = AATCTGTAACGTTTCAGATT Gene: mll3319: Sugar ABC transporter, substrate-binding protein |
|
|
*
Rhizobium etli CFN 42 Site: position = -33 score = 5.43618 sequence = TTCCGGCAACGTTTCAGTGA Gene: RHE_CH02461: Sugar ABC transporter, substrate-binding protein |
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -33 score = 5.43618 sequence = TTCCGGCAACGTTTCAGTGA Gene: RL2796: Sugar ABC transporter, substrate-binding protein |
*
Rhizobium sp. NGR234 Site: position = -32 score = 5.78891 sequence = TTACGGTAACGTTACAGTGA Gene: NGR_c17830: Sugar ABC transporter, substrate-binding protein |
|
*
Sinorhizobium meliloti 1021 Site: position = -32 score = 5.71385 sequence = TTACGGCAACGTTACAGTGA Gene: SMc04259: Sugar ABC transporter, substrate-binding protein |
|
Sugar ABC transporter, substrate-binding protein |
| SMc04258 |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -28 score = 5.58138 sequence = TGACTGTAACGTTACAGGAG Gene: Atu3351: Sugar ABC transporter, inner membrane protein |
|
|
|
|
|
Gene: mll3316: Sugar ABC transporter, inner membrane protein |
|
|
Gene: RHE_CH02460: Sugar ABC transporter, inner membrane protein |
Gene: RL2795: Sugar ABC transporter, inner membrane protein |
Gene: NGR_c17820: Sugar ABC transporter, inner membrane protein |
|
Gene: SMc04258: Sugar ABC transporter, inner membrane protein |
|
Sugar ABC transporter, inner membrane protein |
| SMc04257 |
Gene: Atu3350: Sugar ABC transporter, inner membrane protein |
|
|
|
|
|
Gene: mll3315: Sugar ABC transporter, inner membrane protein |
|
|
Gene: RHE_CH02459: Sugar ABC transporter, inner membrane protein |
Gene: RL2794: Sugar ABC transporter, inner membrane protein |
Gene: NGR_c17810: Sugar ABC transporter, inner membrane protein |
|
Gene: SMc04257: Sugar ABC transporter, inner membrane protein |
|
Sugar ABC transporter, inner membrane protein |
| SMc04256 |
Gene: Atu3349: Sugar ABC transporter, ATP-binding protein |
|
|
|
|
|
Gene: mll3314: Sugar ABC transporter, ATP-binding protein |
|
|
Gene: RHE_CH02458: Sugar ABC transporter, ATP-binding protein |
Gene: RL2793: Sugar ABC transporter, ATP-binding protein |
Gene: NGR_c17800: Sugar ABC transporter, ATP-binding protein |
|
Gene: SMc04256: Sugar ABC transporter, ATP-binding protein |
|
Sugar ABC transporter, ATP-binding protein |
| manA |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -150 score = 5.53351 sequence = TTACGGTAACGTTGCCGGAG Gene: Atu1523: Beta-mannosidase (EC 3.2.1.25) |
|
|
|
|
|
|
|
|
Gene: RHE_CH02457: Beta-mannosidase (EC 3.2.1.25) |
Gene: RL2792: Beta-mannosidase (EC 3.2.1.25) |
Gene: NGR_c17790: Beta-mannosidase (EC 3.2.1.25) |
|
Gene: SMc04255: Beta-mannosidase (EC 3.2.1.25) |
|
Beta-mannosidase (EC 3.2.1.25) |
| COG1082 |
Gene: Atu3348: Sugar phosphate isomerases/epimerases |
|
|
|
|
|
Gene: mll3313: Sugar phosphate isomerases/epimerases |
|
|
Gene: RHE_CH02456: Sugar phosphate isomerases/epimerases |
Gene: RL2791: Sugar phosphate isomerases/epimerases |
Gene: NGR_c17780: Sugar phosphate isomerases/epimerases |
|
Gene: SMc04254: Sugar phosphate isomerases/epimerases |
|
Sugar phosphate isomerases/epimerases |
| COG0673 |
Gene: Atu3347: Predicted dehydrogenases and related proteins |
|
|
|
|
|
Gene: mll3311: Predicted dehydrogenases and related proteins |
|
|
Gene: RHE_CH02455: Predicted dehydrogenases and related proteins |
Gene: RL2790: Predicted dehydrogenases and related proteins |
Gene: NGR_c17770: Predicted dehydrogenases and related proteins |
|
Gene: SMc04253: Predicted dehydrogenases and related proteins |
|
Predicted dehydrogenases and related proteins |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |