Regulon of SMc04260 in Mesorhizobium loti MAFF303099

Properties
Regulator type:	Transcription factor
TF locus tag:	mlr3320
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	SMc04260 - Rhizobiales
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -116 Score: 5.7 Sequence: AATCTGTAACGTTTCAGTAT Locus tag: mlr3320 Name: SMc04260 Funciton: Transcriptional regulator, LacI family
	mlr3320	SMc04260	Transcriptional regulator, LacI family
Position: -35 Score: 5.6 Sequence: AATCTGTAACGTTTCAGATT Locus tag: mll3319 Name: SMc04259 Funciton: Sugar ABC transporter, substrate-binding protein Locus tag: mll3316 Name: SMc04258 Funciton: Sugar ABC transporter, inner membrane protein Locus tag: mll3315 Name: SMc04257 Funciton: Sugar ABC transporter, inner membrane protein Locus tag: mll3314 Name: SMc04256 Funciton: Sugar ABC transporter, ATP-binding protein Locus tag: mll3313 Name: COG1082 Funciton: Sugar phosphate isomerases/epimerases Locus tag: mll3311 Name: COG0673 Funciton: Predicted dehydrogenases and related proteins
	mll3319	SMc04259	Sugar ABC transporter, substrate-binding protein
	mll3316	SMc04258	Sugar ABC transporter, inner membrane protein
	mll3315	SMc04257	Sugar ABC transporter, inner membrane protein
	mll3314	SMc04256	Sugar ABC transporter, ATP-binding protein
	mll3313	COG1082	Sugar phosphate isomerases/epimerases
	mll3311	COG0673	Predicted dehydrogenases and related proteins

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD