Regulon of SMc04260 in Sinorhizobium meliloti 1021

Properties
Regulator type:	Transcription factor
TF locus tag:	SMc04260
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	SMc04260 - Rhizobiales
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -143 Score: 5.6 Sequence: CTACTGTATCGTTACAGATT Locus tag: SMc04260 Name: SMc04260 Funciton: Transcriptional regulator, LacI family
	SMc04260	SMc04260	Transcriptional regulator, LacI family
Position: -32 Score: 5.7 Sequence: TTACGGCAACGTTACAGTGA Locus tag: SMc04259 Name: SMc04259 Funciton: Sugar ABC transporter, substrate-binding protein Locus tag: SMc04258 Name: SMc04258 Funciton: Sugar ABC transporter, inner membrane protein Locus tag: SMc04257 Name: SMc04257 Funciton: Sugar ABC transporter, inner membrane protein Locus tag: SMc04256 Name: SMc04256 Funciton: Sugar ABC transporter, ATP-binding protein Locus tag: SMc04255 Name: manB Funciton: Beta-mannosidase (EC 3.2.1.25) Locus tag: SMc04254 Name: COG1082 Funciton: Sugar phosphate isomerases/epimerases Locus tag: SMc04253 Name: COG0673 Funciton: Predicted dehydrogenases and related proteins
	SMc04259	SMc04259	Sugar ABC transporter, substrate-binding protein
	SMc04258	SMc04258	Sugar ABC transporter, inner membrane protein
	SMc04257	SMc04257	Sugar ABC transporter, inner membrane protein
	SMc04256	SMc04256	Sugar ABC transporter, ATP-binding protein
	SMc04255	manB	Beta-mannosidase (EC 3.2.1.25)
	SMc04254	COG1082	Sugar phosphate isomerases/epimerases
	SMc04253	COG0673	Predicted dehydrogenases and related proteins

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD