Regulon of SMc04260 in Rhizobium etli CFN 42

Properties
Regulator type:	Transcription factor
TF locus tag:	RHE_CH02462
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	SMc04260 - Rhizobiales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -108 Score: 5.9 Sequence: CTACTGTAACGTTGCAGTTT Locus tag: RHE_CH03640 Name: bglSch Funciton: Beta-glucosidase
	RHE_CH03640	bglSch	Beta-glucosidase
Position: -33 Score: 5.4 Sequence: TTCCGGCAACGTTTCAGTGA Locus tag: RHE_CH02461 Name: SMc04259 Funciton: Sugar ABC transporter, substrate-binding protein Locus tag: RHE_CH02460 Name: SMc04258 Funciton: Sugar ABC transporter, inner membrane protein Locus tag: RHE_CH02459 Name: SMc04257 Funciton: Sugar ABC transporter, inner membrane protein Locus tag: RHE_CH02458 Name: SMc04256 Funciton: Sugar ABC transporter, ATP-binding protein
	RHE_CH02461	SMc04259	Sugar ABC transporter, substrate-binding protein
	RHE_CH02460	SMc04258	Sugar ABC transporter, inner membrane protein
	RHE_CH02459	SMc04257	Sugar ABC transporter, inner membrane protein
	RHE_CH02458	SMc04256	Sugar ABC transporter, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD