Regulon of SMc04260 in Rhizobium leguminosarum bv. viciae 3841

Properties
Regulator type:	Transcription factor
TF locus tag:	RL2797
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	SMc04260 - Rhizobiales
Statistics of regulated genes:
- Genes	9
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -33 Score: 5.4 Sequence: TTCCGGCAACGTTTCAGTGA Locus tag: RL2796 Name: SMc04259 Funciton: Sugar ABC transporter, substrate-binding protein Locus tag: RL2795 Name: SMc04258 Funciton: Sugar ABC transporter, inner membrane protein Locus tag: RL2794 Name: SMc04257 Funciton: Sugar ABC transporter, inner membrane protein Locus tag: RL2793 Name: SMc04256 Funciton: Sugar ABC transporter, ATP-binding protein Locus tag: RL2792 Name: null Funciton: Beta-mannosidase (EC 3.2.1.25) Locus tag: RL2791 Name: COG1082 Funciton: Sugar phosphate isomerases/epimerases Locus tag: RL2790 Name: COG0673 Funciton: Predicted dehydrogenases and related proteins
	RL2796	SMc04259	Sugar ABC transporter, substrate-binding protein
	RL2795	SMc04258	Sugar ABC transporter, inner membrane protein
	RL2794	SMc04257	Sugar ABC transporter, inner membrane protein
	RL2793	SMc04256	Sugar ABC transporter, ATP-binding protein
	RL2792		Beta-mannosidase (EC 3.2.1.25)
	RL2791	COG1082	Sugar phosphate isomerases/epimerases
	RL2790	COG0673	Predicted dehydrogenases and related proteins
Position: -102 Score: 5.7 Sequence: CTCCTGCAACGTTGCAGTTT Locus tag: RL4168 Name: bglSch Funciton: Beta-glucosidase
	RL4168	bglSch	Beta-glucosidase
Position: -119 Score: 5.6 Sequence: CTACTGTATCGTTACAGATT Locus tag: RL2797 Name: SMc04260 Funciton: Transcriptional regulator, LacI family
	RL2797	SMc04260	Transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD