Regulon of SMc04260 in Rhizobium sp. NGR234

Properties
Regulator type:	Transcription factor
TF locus tag:	NGR_c17850
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	SMc04260 - Rhizobiales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -175 Score: 5.6 Sequence: CTACTGTATCGTTACAGATA Locus tag: NGR_c17850 Name: SMc04260 Funciton: Transcriptional regulator, LacI family
	NGR_c17850	SMc04260	Transcriptional regulator, LacI family
Position: -32 Score: 5.8 Sequence: TTACGGTAACGTTACAGTGA Locus tag: NGR_c17830 Name: SMc04259 Funciton: Sugar ABC transporter, substrate-binding protein
	NGR_c17830	SMc04259	Sugar ABC transporter, substrate-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD