Regulon of SMc04260 in Agrobacterium tumefaciens str. C58 (Cereon)

Properties
Regulator type:	Transcription factor
TF locus tag:	Atu1522
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	SMc04260 - Rhizobiales
Statistics of regulated genes:
- Genes	8
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -105 Score: 5.1 Sequence: ATCCTGAAACGTTGTAGATT Locus tag: Atu4485 Name: bgl Funciton: Beta-glucosidase
	Atu4485	bgl	Beta-glucosidase
Position: -28 Score: 5.6 Sequence: TGACTGTAACGTTACAGGAG Locus tag: Atu3351 Name: SMc04258 Funciton: Sugar ABC transporter, inner membrane protein Locus tag: Atu3350 Name: SMc04257 Funciton: Sugar ABC transporter, inner membrane protein Locus tag: Atu3349 Name: SMc04256 Funciton: Sugar ABC transporter, ATP-binding protein Locus tag: Atu3348 Name: COG1082 Funciton: Sugar phosphate isomerases/epimerases Locus tag: Atu3347 Name: COG0673 Funciton: Predicted dehydrogenases and related proteins
	Atu3351	SMc04258	Sugar ABC transporter, inner membrane protein
	Atu3350	SMc04257	Sugar ABC transporter, inner membrane protein
	Atu3349	SMc04256	Sugar ABC transporter, ATP-binding protein
	Atu3348	COG1082	Sugar phosphate isomerases/epimerases
	Atu3347	COG0673	Predicted dehydrogenases and related proteins
Position: -32 Score: 5.7 Sequence: CTACTGCAACGTTTCAGTGA Locus tag: Atu3352 Name: SMc04259 Funciton: Sugar ABC transporter, substrate-binding protein
	Atu3352	SMc04259	Sugar ABC transporter, substrate-binding protein
Position: -150 Score: 5.5 Sequence: TTACGGTAACGTTGCCGGAG Locus tag: Atu1523 Name: manA Funciton: Beta-mannosidase (EC 3.2.1.25)
	Atu1523	manA	Beta-mannosidase (EC 3.2.1.25)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD