Regulog SoxR - Rhodobacterales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Superoxide stress response |
| Effector: | Paraquat |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhodobacterales
- By trascription factor - SoxR
- By TF family - MerR
- By effector - Paraquat
- By pathway - Superoxide stress response
| Genome | Genes | Operons |
|---|---|---|
| Rhodobacter sphaeroides 2.4.1 | ||
| Paracoccus denitrificans PD1222 | ||
| Jannaschia sp. CCS1 | ||
| Rhodobacterales bacterium HTCC2654 | ||
| Oceanicola granulosus HTCC2516 | 2 | 2 |
| Loktanella vestfoldensis SKA53 | ||
| Oceanicola batsensis HTCC2597 | ||
| Roseovarius nubinhibens ISM | 2 | 2 |
| Roseovarius sp. 217 | ||
| Sulfitobacter sp. EE-36 | 2 | 2 |
| Silicibacter TM1040 | 3 | 3 |
| Silicibacter pomeroyi DSS-3 | 2 | 2 |
| Roseobacter sp. MED193 | 3 | 3 |
| Hyphomonas neptunium ATCC 15444 | 2 | 2 |
| Oceanicaulis alexandrii HTCC2633 | 2 | 2 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| soxR |
|
|
|
|
*
Oceanicola granulosus HTCC2516 Site: position = -36 score = 6.22183 sequence = TTCTCAAGTTAACTTCAGAT Gene: OG2516_02024: Redox-sensitive transcriptional activator, MerR family |
|
|
*
Roseovarius nubinhibens ISM Site: position = -36 score = 6.45993 sequence = TTCTCAAGTTAACTTGAGAT Gene: ISM_04630: Redox-sensitive transcriptional activator, MerR family |
|
*
Sulfitobacter sp. EE-36 Site: position = -38 score = 5.95359 sequence = TTCTAAACCTAAGTTTAGGT Gene: EE36_04103: Redox-sensitive transcriptional activator, MerR family |
*
Silicibacter TM1040 Site: position = -103 score = 6.07595 sequence = TTCTAAACCTAACTTTAGCT Gene: TM1040_3746: Redox-sensitive transcriptional activator, MerR family |
*
Silicibacter pomeroyi DSS-3 Site: position = -43 score = 6.07595 sequence = TTCTAAACCTAACTTTAGGT Gene: SPO0314: Redox-sensitive transcriptional activator, MerR family |
*
Roseobacter sp. MED193 Site: position = -57 score = 6.07595 sequence = TTCTAAACCTAACTTTAGCT Gene: MED193_10733: Redox-sensitive transcriptional activator, MerR family |
*
Hyphomonas neptunium ATCC 15444 Site: position = -35 score = 6.1795 sequence = ATCTCAAGTTCACTTTAGAT Gene: HNE_3426: Redox-sensitive transcriptional activator, MerR family |
*
Oceanicaulis alexandrii HTCC2633 Site: position = -54 score = 6.33757 sequence = TTCTCAAGCTAACTTGAGAT Gene: OA2633_12050: Redox-sensitive transcriptional activator, MerR family |
Redox-sensitive transcriptional activator, MerR family |
| CRON 2. | ||||||||||||||||
| PF00903 |
|
|
|
|
*
Oceanicola granulosus HTCC2516 Site: position = -73 score = 6.22183 sequence = ATCTGAAGTTAACTTGAGAA Gene: OG2516_02029: Glyoxalase/bleomycin resistance protein/dioxygenase |
|
|
*
Roseovarius nubinhibens ISM Site: position = -62 score = 6.45993 sequence = ATCTCAAGTTAACTTGAGAA Gene: ISM_04625: Glyoxalase/bleomycin resistance protein/dioxygenase |
|
*
Sulfitobacter sp. EE-36 Site: position = -69 score = 5.95359 sequence = ACCTAAACTTAGGTTTAGAA Gene: EE36_04108: Glyoxalase/bleomycin resistance protein/dioxygenase |
*
Silicibacter TM1040 Site: position = -62 score = 6.07595 sequence = AGCTAAAGTTAGGTTTAGAA Gene: TM1040_3747: Glyoxalase/bleomycin resistance protein/dioxygenase |
*
Silicibacter pomeroyi DSS-3 Site: position = -61 score = 6.07595 sequence = ACCTAAAGTTAGGTTTAGAA Gene: SPO0313: Glyoxalase/bleomycin resistance protein/dioxygenase |
*
Roseobacter sp. MED193 Site: position = -71 score = 6.07595 sequence = AGCTAAAGTTAGGTTTAGAA Gene: MED193_10738: Glyoxalase/bleomycin resistance protein/dioxygenase |
*
Hyphomonas neptunium ATCC 15444 Site: position = -66 score = 6.1795 sequence = ATCTAAAGTGAACTTGAGAT Gene: HNE_3425: Glyoxalase/bleomycin resistance protein/dioxygenase |
|
Glyoxalase/bleomycin resistance protein/dioxygenase |
| CRON 3. | ||||||||||||||||
| PF01370 |
|
|
|
|
|
|
|
|
|
|
Gene: TM1040_0373: NAD-dependent epimerase/dehydratase |
Gene: SPO2846: NAD-dependent epimerase/dehydratase |
*
Roseobacter sp. MED193 Site: position = -57 score = 6.23756 sequence = AGCTAAAGTTAGCTTTAGAT Gene: MED193_22126: NAD-dependent epimerase/dehydratase |
|
|
NAD-dependent epimerase/dehydratase |
| CRON 4. | ||||||||||||||||
| OA2633_12045 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
*
Oceanicaulis alexandrii HTCC2633 Site: position = -63 score = 6.33757 sequence = ATCTCAAGTTAGCTTGAGAA Gene: OA2633_12045: hypothetical protein |
hypothetical protein |
| CRON 5. | ||||||||||||||||
| PF00903 |
|
|
|
|
|
|
|
|
|
|
*
Silicibacter TM1040 Site: position = -93 score = 5.75271 sequence = ATCTAAAGTGAGCTTGAGGA Gene: TM1040_1863: Glyoxalase/bleomycin resistance protein/dioxygenase |
Gene: SPOA0321: Glyoxalase/bleomycin resistance protein/dioxygenase |
|
|
|
Glyoxalase/bleomycin resistance protein/dioxygenase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |